<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/44724?offset=150</link>
	<atom:link href="https://bioinformaticsonline.com/related/44724?offset=150" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/42693/dna-rna-meme</guid>
	<pubDate>Thu, 28 Jan 2021 11:23:14 -0600</pubDate>
	<link>https://bioinformaticsonline.com/file/view/42693/dna-rna-meme</link>
	<title><![CDATA[DNA RNA MEME]]></title>
	<description><![CDATA[<p>Explain the DNA and RNA with picture ...</p>]]></description>
	<dc:creator>Neel</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/42693" length="41627" type="image/jpeg" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/44709/a-step-by-step-guide-to-running-blast-offline</guid>
	<pubDate>Sat, 07 Dec 2024 22:32:37 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/44709/a-step-by-step-guide-to-running-blast-offline</link>
	<title><![CDATA[A Step-by-Step Guide to Running BLAST Offline]]></title>
	<description><![CDATA[<p>BLAST (Basic Local Alignment Search Tool) is a powerful algorithm used to compare nucleotide or protein sequences to sequence databases, identifying regions of similarity. Running BLAST offline provides more control, ensures data security, and allows customization for specific research needs. Here&rsquo;s a detailed guide to set up and run BLAST locally on your system.</p><hr><h3>Step 1: <strong>Install BLAST</strong></h3><ol>
<li>
<p><strong>Download BLAST</strong>:</p>
<ul>
<li>Visit the <a href="https://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/LATEST/">NCBI BLAST+ download page</a> to download the appropriate version for your operating system (Windows, macOS, or Linux).</li>
</ul>
</li>
<li>
<p><strong>Install BLAST</strong>:</p>
<ul>
<li>Extract the downloaded archive. For Linux/Mac, use:
<pre><code>tar -xvzf ncbi-blast-*.tar.gz
cd ncbi-blast-*
</code></pre>
</li>
<li>Add the BLAST binary folder to your system PATH for easier access:
<pre><code>export PATH=$PATH:/path/to/ncbi-blast-*/bin
</code></pre>
</li>
</ul>
</li>
<li>
<p><strong>Verify Installation</strong>:<br /> Run the following command to ensure BLAST is installed correctly:</p>
<pre><code>blastn -version
</code></pre>
</li>
</ol><hr><h3>Step 2: <strong>Prepare a Local Database</strong></h3><p>To run BLAST offline, you&rsquo;ll need a sequence database.</p><ol>
<li>
<p><strong>Download a Pre-Built Database (Optional)</strong>:</p>
<ul>
<li>NCBI provides ready-to-use databases such as <code>nt</code>, <code>nr</code>, and <code>Swiss-Prot</code>. Use the <code>update_blastdb.pl</code> script (bundled with BLAST) to download these:
<pre><code>update_blastdb.pl --decompress nt
</code></pre>
</li>
</ul>
</li>
<li>
<p><strong>Create a Custom Database</strong>:<br /> If you have specific sequences to use as a database:</p>
<ul>
<li>Prepare a FASTA file containing the sequences.</li>
<li>Use <code>makeblastdb</code> to create a database:
<pre><code>makeblastdb -in your_sequences.fasta -dbtype [nucl|prot] -out custom_db
</code></pre>
Replace <code>[nucl|prot]</code> with <code>nucl</code> for nucleotide sequences or <code>prot</code> for protein sequences.</li>
</ul>
</li>
</ol><hr><h3>Step 3: <strong>Prepare the Query Sequence</strong></h3><ul>
<li>Save your query sequence(s) in FASTA format.</li>
<li>Ensure the file is properly formatted, with a header line starting with <code>&gt;</code> followed by the sequence name, and the sequence on subsequent lines.</li>
</ul><p>Example:</p><pre><code>&gt;query_sequence
ATGCGTAGCTAGCGTAGCTAGCTAGCTA
</code></pre><hr><h3>Step 4: <strong>Run BLAST</strong></h3><ol>
<li>
<p><strong>Choose the Appropriate BLAST Tool</strong>:<br /> Depending on your data type:</p>
<ul>
<li><strong>blastn</strong>: For nucleotide-nucleotide searches.</li>
<li><strong>blastp</strong>: For protein-protein searches.</li>
<li><strong>blastx</strong>: Translates nucleotide sequences into proteins and compares them to a protein database.</li>
<li><strong>tblastn</strong>: Compares protein sequences to a nucleotide database.</li>
<li><strong>tblastx</strong>: Translates both nucleotide query and database sequences.</li>
</ul>
</li>
<li>
<p><strong>Run the Command</strong>:<br /> Example command for <code>blastn</code>:</p>
<pre><code>blastn -query query.fasta -db custom_db -out results.txt -outfmt 6 -evalue 1e-5
</code></pre>
<p><strong>Explanation of Parameters</strong>:</p>
<ul>
<li><code>-query</code>: Specifies the query file.</li>
<li><code>-db</code>: Points to the local database.</li>
<li><code>-out</code>: Output file name.</li>
<li><code>-outfmt</code>: Output format (e.g., 6 for tabular format).</li>
<li><code>-evalue</code>: E-value cutoff for significance.</li>
</ul>
</li>
</ol><hr><h3>Step 5: <strong>Interpret Results</strong></h3><ol>
<li>
<p><strong>Output Formats</strong>:</p>
<ul>
<li><strong>Default (outfmt 0)</strong>: Human-readable format.</li>
<li><strong>Tabular (outfmt 6)</strong>: Includes fields like query ID, subject ID, percent identity, alignment length, etc.</li>
</ul>
</li>
<li>
<p><strong>Analyze Results</strong>:<br /> Use tools like <code>grep</code>, Python, or R to parse and filter results for downstream analysis.</p>
</li>
</ol><hr><h3>Step 6: <strong>Optimize Performance</strong></h3><p>For large datasets, BLAST can be resource-intensive. To improve performance:</p><ol>
<li>
<p><strong>Multithreading</strong>:<br /> Use the <code>-num_threads</code> option to leverage multiple CPU cores:</p>
<pre><code>blastn -query query.fasta -db custom_db -out results.txt -num_threads 4
</code></pre>
</li>
<li>
<p><strong>Database Subsetting</strong>:<br /> Split large databases into smaller chunks for faster searches.</p>
</li>
<li>
<p><strong>Adjust Parameters</strong>:</p>
<ul>
<li>Lower the <code>-evalue</code> threshold for stricter matches.</li>
<li>Use <code>-max_target_seqs</code> to limit the number of results per query.</li>
</ul>
</li>
</ol><hr><h3>Step 7: <strong>Update Databases (Optional)</strong></h3><p>If using NCBI databases, regularly update them to ensure the inclusion of the latest sequences:</p><pre><code>update_blastdb.pl --decompress nt
</code></pre><hr><h3>Conclusion</h3><p>Running BLAST offline is a straightforward process that offers flexibility and security for bioinformaticians working with sensitive data. By following this guide, you can harness the power of BLAST to analyze sequences efficiently and gain valuable biological insights.</p><p>For advanced use cases, explore BLAST&rsquo;s customization options, such as custom scoring matrices, filtering, and iterative searches with tools like PSI-BLAST. Happy BLASTing!</p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/35923/basic-command-line-to-run-blast</guid>
	<pubDate>Wed, 14 Mar 2018 05:10:34 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/35923/basic-command-line-to-run-blast</link>
	<title><![CDATA[Basic command-line to run BLAST]]></title>
	<description><![CDATA[<p>&nbsp;</p><p>The goal of this tutorial is to run you through a demonstration of the command line, which you may not have seen or used much before.</p><p>All of the commands below can copy/pasted.</p><div id="install-software"><h2>Install software<a href="http://angus.readthedocs.io/en/2016/running-command-line-blast.html#install-software" title="Permalink to this headline"></a></h2><p>Copy and paste the following commands</p><div><div><pre>sudo apt-get update &amp;&amp; sudo apt-get -y install python ncbi-blast+
</pre></div></div><p>This updates the software list and installs the Python programming language and NCBI BLAST+.</p></div><div id="get-data"><h2>Get Data<a href="http://angus.readthedocs.io/en/2016/running-command-line-blast.html#get-data" title="Permalink to this headline"></a></h2><p>Grab some data to play with. Grab some cow and human RefSeq proteins:</p><div><div><pre>wget ftp://ftp.ncbi.nih.gov/refseq/B_taurus/mRNA_Prot/cow.1.protein.faa.gz
wget ftp://ftp.ncbi.nih.gov/refseq/H_sapiens/mRNA_Prot/human.1.protein.faa.gz
</pre></div></div><p>This is only the first part of the human and cow protein files - there are 24 files total for human.</p><p>The database files are both gzipped, so lets unzip them</p><div><div><pre>gunzip *gz
ls
</pre></div></div><p>Take a look at the head of each file:</p><div><div><pre>head cow.1.protein.faa
head human.1.protein.faa
</pre></div></div><p>These are protein sequences in FASTA format. FASTA format is something many of you have probably seen in one form or another &ndash; it&rsquo;s pretty ubiquitous. It&rsquo;s just a text file, containing records; each record starts with a line beginning with a &lsquo;&gt;&rsquo;, and then contains one or more lines of sequence text.</p><p>Note that the files are in fasta format, even though they end if &rdquo;.faa&rdquo; instead of the usual &rdquo;.fasta&rdquo;. This NCBI&rsquo;s way of denoting that this is a fasta file with amino acids instead of nucleotides.</p><p>How many sequences are in each one?</p><div><div><pre>grep -c '^&gt;' cow.1.protein.faa
grep -c '^&gt;' human.1.protein.faa
</pre></div></div><p>This grep command uses the c flag, which reports a count of lines with match to the pattern. In this case, the pattern is a regular expression, meaning match only lines that begin with a &gt;.</p><p>This is a bit too big, lets take a smaller set for practice. Lets take the first two sequences of the cow proteins, which we can see are on the first 6 lines</p><div><div><pre>head -6 cow.1.protein.faa &gt; cow.small.faa
</pre></div></div></div><div id="blast"><h2>BLAST<a href="http://angus.readthedocs.io/en/2016/running-command-line-blast.html#blast" title="Permalink to this headline"></a></h2><p>Now we can blast these two cow sequences against the set of human sequences. First, we need to tell blast about our database. BLAST needs to do some pre-work on the database file prior to searching. This helps to make the software work a lot faster. Because you installed your own version of the sotware, you need to tell the shell where the software is located. Use the full path and the makeblastdb command:</p><div><div><pre>makeblastdb -in human.1.protein.faa -dbtype prot
ls
</pre></div></div><p>Note that this makes a lot of extra files, with the same name as the database plus new extensions (.pin, .psq, etc). To make blast work, these files, called index files, must be in the same directory as the fasta file.</p><p><br /> blastp [-h] [-help] [-import_search_strategy filename]<br /> [-export_search_strategy filename] [-task task_name] [-db database_name]<br /> [-dbsize num_letters] [-gilist filename] [-seqidlist filename]<br /> [-negative_gilist filename] [-negative_seqidlist filename]<br /> [-entrez_query entrez_query] [-db_soft_mask filtering_algorithm]<br /> [-db_hard_mask filtering_algorithm] [-subject subject_input_file]<br /> [-subject_loc range] [-query input_file] [-out output_file]<br /> [-evalue evalue] [-word_size int_value] [-gapopen open_penalty]<br /> [-gapextend extend_penalty] [-qcov_hsp_perc float_value]<br /> [-max_hsps int_value] [-xdrop_ungap float_value] [-xdrop_gap float_value]<br /> [-xdrop_gap_final float_value] [-searchsp int_value]<br /> [-sum_stats bool_value] [-seg SEG_options] [-soft_masking soft_masking]<br /> [-matrix matrix_name] [-threshold float_value] [-culling_limit int_value]<br /> [-best_hit_overhang float_value] [-best_hit_score_edge float_value]<br /> [-window_size int_value] [-lcase_masking] [-query_loc range]<br /> [-parse_deflines] [-outfmt format] [-show_gis]<br /> [-num_descriptions int_value] [-num_alignments int_value]<br /> [-line_length line_length] [-html] [-max_target_seqs num_sequences]<br /> [-num_threads int_value] [-ungapped] [-remote] [-comp_based_stats compo]<br /> [-use_sw_tback] [-version]</p><p>Now we can run the blast job. We will use blastp, which is appropriate for protein to protein comparisons.</p><div><div><pre>blastp -query cow.small.faa -db human.1.protein.faa
</pre></div></div><p>This gives us a lot of information on the terminal screen. But this is difficult to save and use later - Blast also gives the option of saving the text to a file.</p><div><div><pre>    blastp -query cow.small.faa -db human.1.protein.faa -out cow_vs_human_blast_results.txt
ls
</pre></div></div><p>Take a look at the results using less. Note that there can be more than one match between the query and the same subject. These are referred to as high-scoring segment pairs (HSPs).</p><div><div><pre>less cow_vs_human_blast_results.txt
</pre></div></div><p>So how do you know about all the options, such as the flag to create an output file? Lets also take a look at the help pages. Unfortunately there are no man pages (those are usually reserved for shell commands, but some software authors will provide them as well), but there is a text help output</p><div><div><pre>blastp -help
</pre></div></div><p>To scroll through slowly</p><div><div><pre>blastp -help | less
</pre></div></div><p>To quit the less screen, press the q key.</p><p>Parameters of interest include the -evalue (Default is 10?!?) and the -outfmt</p><p>Lets filter for more statistically significant matches with a different output format:</p><div><div><pre>blastp \
-query cow.small.faa \
-db human.1.protein.faa \
-out cow_vs_human_blast_results.tab \
-evalue 1e-5 \
-outfmt 7
</pre></div></div><p>I broke the long single command into many lines with by &ldquo;escaping&rdquo; the newline. That forward slash tells the command line &ldquo;Wait, I&rsquo;m not done yet!&rdquo;. So it waits for the next line of the command before executing.</p><p>Check out the results with less.</p><p>Lets try a medium sized data set next</p><div><div><pre>head -199 cow.1.protein.faa &gt; cow.medium.faa
</pre></div></div><p>What size is this db?</p><div><div><pre>grep -c '^&gt;' cow.medium.faa
</pre></div></div><p>Lets run the blast again, but this time lets return only the best hit for each query.</p><div><div><pre>blastp \
-query cow.medium.faa \
-db human.1.protein.faa \
-out cow_vs_human_blast_results.tab \
-evalue 1e-5 \
-outfmt 6 \
-max_target_seqs 1
</pre></div></div></div><div id="summary"><h2>Summary<a href="http://angus.readthedocs.io/en/2016/running-command-line-blast.html#summary" title="Permalink to this headline"></a></h2><p>Review:</p><ul>
<li>command line programs such as blast use flags to get information about how and what to do</li>
<li>blast options can be found by typing&nbsp;<cite>blastp -help</cite></li>
<li>break a command up over many lines by using&nbsp;<a href="http://angus.readthedocs.io/en/2016/running-command-line-blast.html#id1">`</a>` to &ldquo;escape&rdquo; the new line</li>
</ul><p>&nbsp;</p><p>Blastn</p><p>blastn [-h] [-help] [-import_search_strategy filename]<br /> [-export_search_strategy filename] [-task task_name] [-db database_name]<br /> [-dbsize num_letters] [-gilist filename] [-seqidlist filename]<br /> [-negative_gilist filename] [-negative_seqidlist filename]<br /> [-entrez_query entrez_query] [-db_soft_mask filtering_algorithm]<br /> [-db_hard_mask filtering_algorithm] [-subject subject_input_file]<br /> [-subject_loc range] [-query input_file] [-out output_file]<br /> [-evalue evalue] [-word_size int_value] [-gapopen open_penalty]<br /> [-gapextend extend_penalty] [-perc_identity float_value]<br /> [-qcov_hsp_perc float_value] [-max_hsps int_value]<br /> [-xdrop_ungap float_value] [-xdrop_gap float_value]<br /> [-xdrop_gap_final float_value] [-searchsp int_value]<br /> [-sum_stats bool_value] [-penalty penalty] [-reward reward] [-no_greedy]<br /> [-min_raw_gapped_score int_value] [-template_type type]<br /> [-template_length int_value] [-dust DUST_options]<br /> [-filtering_db filtering_database]<br /> [-window_masker_taxid window_masker_taxid]<br /> [-window_masker_db window_masker_db] [-soft_masking soft_masking]<br /> [-ungapped] [-culling_limit int_value] [-best_hit_overhang float_value]<br /> [-best_hit_score_edge float_value] [-window_size int_value]<br /> [-off_diagonal_range int_value] [-use_index boolean] [-index_name string]<br /> [-lcase_masking] [-query_loc range] [-strand strand] [-parse_deflines]<br /> [-outfmt format] [-show_gis] [-num_descriptions int_value]<br /> [-num_alignments int_value] [-line_length line_length] [-html]<br /> [-max_target_seqs num_sequences] [-num_threads int_value] [-remote]<br /> [-version]</p><p>DESCRIPTION<br /> Nucleotide-Nucleotide BLAST 2.7.0+</p></div>]]></description>
	<dc:creator>Shruti Paniwala</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/43732/spades-tutorial-pdf</guid>
	<pubDate>Tue, 01 Feb 2022 04:56:43 -0600</pubDate>
	<link>https://bioinformaticsonline.com/file/view/43732/spades-tutorial-pdf</link>
	<title><![CDATA[Spades tutorial PDF]]></title>
	<description><![CDATA[<p>SPAdes&mdash;St. Petersburg genome Assembler&mdash;was originally developed for de novo assembly of genome sequencing data produced for cultivated microbial isolates and for single-cell genomic DNA sequencing. With time, the functionality of SPAdes was extended to enable assembly of IonTorrent data, as well as hybrid assembly from short and long reads (PacBio and Oxford Nanopore). In this article we present protocols for five different assembly pipelines that comprise the SPAdes package and that are used for assembly of metagenomes and transcriptomes as well as assembly of putative plasmids and biosynthetic gene clusters from whole-genome sequencing and metagenomic datasets.&nbsp;</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/43732" length="268093" type="application/pdf" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/37225/installing-trinity</guid>
	<pubDate>Tue, 03 Jul 2018 04:31:15 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/37225/installing-trinity</link>
	<title><![CDATA[Installing Trinity !]]></title>
	<description><![CDATA[
<p>Download this https://github.com/trinityrnaseq/trinityrnaseq/releases/tag/Trinity-v2.6.6</p>

<p>➜ cd trinityrnaseq-Trinity-v2.6.6</p>

<p>➜  trinityrnaseq-Trinity-v2.6.6 git:(master) ✗ make<br />Using gnu compiler for Inchworm and Chrysalis<br />cd Inchworm &amp;&amp; (test -e configure || autoreconf) \<br />                &amp;&amp; sh ./configure --prefix=`pwd`  &amp;&amp; make install<br />checking for a BSD-compatible install... /usr/bin/install -c<br />checking whether build environment is sane... yes<br />checking for a thread-safe mkdir -p... /bin/mkdir -p<br />checking for gawk... gawk<br />checking whether make sets $(MAKE)... yes<br />checking for g++... g++<br />checking whether the C++ compiler works... yes<br />checking for C++ compiler default output file name... a.out<br />checking for suffix of executables... <br />checking whether we are cross compiling... no<br />checking for suffix of object files... o<br />checking whether we are using the GNU C++ compiler... yes<br />checking whether g++ accepts -g... yes<br />checking for style of include used by make... GNU<br />checking dependency style of g++... gcc3<br />checking for library containing cos... none required<br />configure: creating ./config.status<br />config.status: creating Makefile<br />config.status: creating src/Makefile<br />config.status: creating config.h<br />config.status: config.h is unchanged<br />config.status: executing depfiles commands<br />make[1]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'<br />Making install in src<br />make[2]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/src'<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT Fasta_entry.o -MD -MP -MF .deps/Fasta_entry.Tpo -c -o Fasta_entry.o Fasta_entry.cpp<br />mv -f .deps/Fasta_entry.Tpo .deps/Fasta_entry.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT IRKE_run.o -MD -MP -MF .deps/IRKE_run.Tpo -c -o IRKE_run.o IRKE_run.cpp<br />mv -f .deps/IRKE_run.Tpo .deps/IRKE_run.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT sequenceUtil.o -MD -MP -MF .deps/sequenceUtil.Tpo -c -o sequenceUtil.o sequenceUtil.cpp<br />mv -f .deps/sequenceUtil.Tpo .deps/sequenceUtil.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT IRKE.o -MD -MP -MF .deps/IRKE.Tpo -c -o IRKE.o IRKE.cpp<br />mv -f .deps/IRKE.Tpo .deps/IRKE.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT KmerCounter.o -MD -MP -MF .deps/KmerCounter.Tpo -c -o KmerCounter.o KmerCounter.cpp<br />mv -f .deps/KmerCounter.Tpo .deps/KmerCounter.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT string_util.o -MD -MP -MF .deps/string_util.Tpo -c -o string_util.o string_util.cpp<br />mv -f .deps/string_util.Tpo .deps/string_util.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT Fasta_reader.o -MD -MP -MF .deps/Fasta_reader.Tpo -c -o Fasta_reader.o Fasta_reader.cpp<br />mv -f .deps/Fasta_reader.Tpo .deps/Fasta_reader.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT stacktrace.o -MD -MP -MF .deps/stacktrace.Tpo -c -o stacktrace.o stacktrace.cpp<br />mv -f .deps/stacktrace.Tpo .deps/stacktrace.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT argProcessor.o -MD -MP -MF .deps/argProcessor.Tpo -c -o argProcessor.o argProcessor.cpp<br />mv -f .deps/argProcessor.Tpo .deps/argProcessor.Po<br />g++ -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2   -o inchworm Fasta_entry.o IRKE_run.o sequenceUtil.o IRKE.o KmerCounter.o string_util.o Fasta_reader.o stacktrace.o argProcessor.o  <br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT cigar_tweaker.o -MD -MP -MF .deps/cigar_tweaker.Tpo -c -o cigar_tweaker.o cigar_tweaker.cpp<br />mv -f .deps/cigar_tweaker.Tpo .deps/cigar_tweaker.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT SAM_entry.o -MD -MP -MF .deps/SAM_entry.Tpo -c -o SAM_entry.o SAM_entry.cpp<br />mv -f .deps/SAM_entry.Tpo .deps/SAM_entry.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT SAM_reader.o -MD -MP -MF .deps/SAM_reader.Tpo -c -o SAM_reader.o SAM_reader.cpp<br />mv -f .deps/SAM_reader.Tpo .deps/SAM_reader.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT Cigar.o -MD -MP -MF .deps/Cigar.Tpo -c -o Cigar.o Cigar.cpp<br />mv -f .deps/Cigar.Tpo .deps/Cigar.Po<br />g++ -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2   -o cigar_tweaker cigar_tweaker.o SAM_entry.o sequenceUtil.o SAM_reader.o Cigar.o string_util.o stacktrace.o Fasta_reader.o Fasta_entry.o  <br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT pull_reads_with_kmers.o -MD -MP -MF .deps/pull_reads_with_kmers.Tpo -c -o pull_reads_with_kmers.o pull_reads_with_kmers.cpp<br />mv -f .deps/pull_reads_with_kmers.Tpo .deps/pull_reads_with_kmers.Po<br />g++ -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2   -o pull_reads_with_kmers pull_reads_with_kmers.o Fasta_reader.o Fasta_entry.o sequenceUtil.o KmerCounter.o string_util.o stacktrace.o argProcessor.o  <br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT FastaToDeBruijn.o -MD -MP -MF .deps/FastaToDeBruijn.Tpo -c -o FastaToDeBruijn.o FastaToDeBruijn.cpp<br />FastaToDeBruijn.cpp: In function ‘void createGraphPerRecord(std::vector &gt;, int, bool, ArgProcessor)’:<br />FastaToDeBruijn.cpp:199:39: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />                 if (seq_region.size() &lt; kmer_length) { continue; }  // can be e<br />                                       ^<br />mv -f .deps/FastaToDeBruijn.Tpo .deps/FastaToDeBruijn.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT DeBruijnGraph.o -MD -MP -MF .deps/DeBruijnGraph.Tpo -c -o DeBruijnGraph.o DeBruijnGraph.cpp<br />mv -f .deps/DeBruijnGraph.Tpo .deps/DeBruijnGraph.Po<br />g++ -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2   -o FastaToDeBruijn FastaToDeBruijn.o argProcessor.o Fasta_reader.o Fasta_entry.o sequenceUtil.o string_util.o stacktrace.o DeBruijnGraph.o  <br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT fastaToKmerCoverageStats.o -MD -MP -MF .deps/fastaToKmerCoverageStats.Tpo -c -o fastaToKmerCoverageStats.o fastaToKmerCoverageStats.cpp<br />fastaToKmerCoverageStats.cpp: In function ‘void populate_kmer_counter_from_reads(KmerCounter&amp;, std::__cxx11::string&amp;)’:<br />fastaToKmerCoverageStats.cpp:226:18: warning: unused variable ‘kmer_length’ [-Wunused-variable]<br />     unsigned int kmer_length = kcounter.get_kmer_length();<br />                  ^<br />mv -f .deps/fastaToKmerCoverageStats.Tpo .deps/fastaToKmerCoverageStats.Po<br />g++ -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2   -o fastaToKmerCoverageStats fastaToKmerCoverageStats.o argProcessor.o Fasta_reader.o Fasta_entry.o sequenceUtil.o string_util.o stacktrace.o KmerCounter.o  <br />make[3]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/src'<br />test -z "/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/bin" || /bin/mkdir -p "/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/bin"<br />  /usr/bin/install -c inchworm cigar_tweaker pull_reads_with_kmers FastaToDeBruijn fastaToKmerCoverageStats '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/bin'<br />make[3]: Nothing to be done for 'install-data-am'.<br />make[3]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/src'<br />make[2]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/src'<br />make[2]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'<br />make[3]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'<br />make[3]: Nothing to be done for 'install-exec-am'.<br />make[3]: Nothing to be done for 'install-data-am'.<br />make[3]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'<br />make[2]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'<br />make[1]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'<br />cd Chrysalis &amp;&amp; make UNSUPPORTED=yes <br />make[1]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Chrysalis'<br />./MakeDepend.cc: In member function ‘bool makefile_builder::dependency::operator&lt;(const makefile_builder::dependency&amp;) const’:<br />./MakeDepend.cc:93:47: warning: suggest parentheses around ‘&amp;&amp;’ within ‘||’ [-Wparentheses]<br />                dependent_ == other.dependent_ &amp;&amp;<br />                                               ^<br />./MakeDepend.cc: In member function ‘bool makefile_builder::subdir_and_target::operator&lt;(const makefile_builder::subdir_and_target&amp;) const’:<br />./MakeDepend.cc:130:41: warning: suggest parentheses around ‘&amp;&amp;’ within ‘||’ [-Wparentheses]<br />                subdir_ == other.subdir_ &amp;&amp;<br />                                         ^<br />./MakeDepend.cc: In function ‘int main(int, char**)’:<br />./MakeDepend.cc:223:20: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings]<br />   char * options = "Ad:g:u:fh";<br />                    ^<br />./MakeDepend.cc: In member function ‘void makefile_builder::DumpDependencies(const string&amp;)’:<br />./MakeDepend.cc:491:46: warning: suggest parentheses around ‘&amp;&amp;’ within ‘||’ [-Wparentheses]<br />       if ( ! this-&gt;FileIsSource( dependent ) &amp;&amp; ! this-&gt;FileIsHeader( dependent<br />                                              ^<br />./MakeDepend.cc:493:44: warning: suggest parentheses around ‘&amp;&amp;’ within ‘||’ [-Wparentheses]<br />            this-&gt;FileIsHeader( dependent ) &amp;&amp; this-&gt;FileIsSource( provider ) ) <br />                                            ^<br />./MakeDepend.cc: In member function ‘bool makefile_builder::FileIsHeader(const string&amp;) const’:<br />./MakeDepend.cc:1339:32: warning: suggest parentheses around ‘&amp;&amp;’ within ‘||’ [-Wparentheses]<br />   return ( filename.size() &gt; 2 &amp;&amp;<br />                                ^<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:04 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./aligns/KmerAlignCore.cc -o obj/aligns/KmerAlignCore.o<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:06 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/AACodons.cc -o obj/analysis/AACodons.o<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:09 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/BreakTransByPairs.cc -o obj/analysis/BreakTransByPairs.o<br />./analysis/BreakTransByPairs.cc: In function ‘int main(int, char**)’:<br />./analysis/BreakTransByPairs.cc:105:14: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />   for (i=0; i &gt; DeBruijnGraph::get_candidate_weldmers(kmer_int_type_t, int)’:<br />./analysis/DeBruijnGraph.cc:473:23: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />     for (int i = 0; i &lt; left_extensions.size(); i++) {<br />                       ^<br />./analysis/DeBruijnGraph.cc:476:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />         for (int j = 0; j &lt; right_extensions.size(); j++) {<br />                           ^<br />./analysis/DeBruijnGraph.cc: In member function ‘void DeBruijnGraph::recursively_construct_kmer_extensions(kmer_int_type_t, std::vector&amp;, std::vector &gt;&amp;, char, std::map&amp;, int)’:<br />./analysis/DeBruijnGraph.cc:513:23: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />     for (int i = 0; i &lt; adjacent_kmers.size(); i++) {<br />                       ^<br />./analysis/DeBruijnGraph.cc:527:41: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />         if (kmer_extension_chars.size() == flank_extension_length) {<br />                                         ^<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:30 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/sequenceUtil.cc -o obj/analysis/sequenceUtil.o<br />./analysis/sequenceUtil.cc: In function ‘bool contains_non_gatc(std::__cxx11::string)’:<br />./analysis/sequenceUtil.cc:33:20: warning: array subscript has type ‘char’ [-Wchar-subscripts]<br />  if (_base_to_int[c] &gt; 3)<br />                    ^<br />./analysis/sequenceUtil.cc: In function ‘kmer_int_type_t kmer_to_intval(std::__cxx11::string)’:<br />./analysis/sequenceUtil.cc:264:26: warning: array subscript has type ‘char’ [-Wchar-subscripts]<br />  int val = _base_to_int[c];<br />                          ^<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:31 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/stacktrace.cc -o obj/analysis/stacktrace.o<br />/bin/rm -f lib_BubbleUpClustering_temp.a<br />ar -qc  lib_BubbleUpClustering_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/BubbleUpClustering.o obj/analysis/DNAVector.o obj/analysis/DeBruijnGraph.o obj/analysis/KmerTable.o obj/analysis/NonRedKmerTable.o obj/analysis/sequenceUtil.o obj/analysis/stacktrace.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./BubbleUpClustering<br />g++ -ggdb3    -fopenmp  -o ./BubbleUpClustering  obj/analysis/BubbleUpClustering.o -L. -lm -pthread     -l_BubbleUpClustering_temp<br />/bin/rm lib_BubbleUpClustering_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:32 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/Chrysalis.cc -o obj/analysis/Chrysalis.o<br />./analysis/Chrysalis.cc: In function ‘int main(int, char**)’:<br />./analysis/Chrysalis.cc:384:28: warning: ignoring return value of ‘int system(const char*)’, declared with attribute warn_unused_result [-Wunused-result]<br />     system(command.c_str());<br />                            ^<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:35 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/TranscriptomeGraph.cc -o obj/analysis/TranscriptomeGraph.o<br />./analysis/TranscriptomeGraph.cc: In function ‘int TranscriptomeGraph(vecDNAVector&amp;, FILE*, int, bool)’:<br />./analysis/TranscriptomeGraph.cc:668:20: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />         for (i=0; i&lt;=d.isize()-k; i++) {<br />                    ^<br />/bin/rm -f lib_Chrysalis_temp.a<br />ar -qc  lib_Chrysalis_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/Chrysalis.o obj/analysis/DNAVector.o obj/analysis/TranscriptomeGraph.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./Chrysalis<br />g++ -ggdb3    -fopenmp  -o ./Chrysalis  obj/analysis/Chrysalis.o -L. -lm -pthread     -l_Chrysalis_temp<br />/bin/rm lib_Chrysalis_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:39 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/CreateIwormFastaBundle.cc -o obj/analysis/CreateIwormFastaBundle.o<br />/bin/rm -f lib_CreateIwormFastaBundle_temp.a<br />ar -qc  lib_CreateIwormFastaBundle_temp.a obj/analysis/AACodons.o obj/analysis/CreateIwormFastaBundle.o obj/analysis/DNAVector.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./CreateIwormFastaBundle<br />g++ -ggdb3    -fopenmp  -o ./CreateIwormFastaBundle  obj/analysis/CreateIwormFastaBundle.o -L. -lm -pthread     -l_CreateIwormFastaBundle_temp<br />/bin/rm lib_CreateIwormFastaBundle_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:42 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/GraphFromFasta.cc -o obj/analysis/GraphFromFasta.o<br />./analysis/GraphFromFasta.cc: In function ‘bool SimpleHalves(const DNAVector&amp;)’:<br />./analysis/GraphFromFasta.cc:255:15: warning: suggest parentheses around ‘&amp;&amp;’ within ‘||’ [-Wparentheses]<br />               &amp;&amp; <br />               ^<br />./analysis/GraphFromFasta.cc: In function ‘void report_iworm_graph(std::map&lt;int, Pool&gt;&amp;, std::map&amp;)’:<br />./analysis/GraphFromFasta.cc:631:31: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />             for (int j = 0; j &lt; adjacent_nodes.size(); j++) {<br />                               ^<br />./analysis/GraphFromFasta.cc: In function ‘int main(int, char**)’:<br />./analysis/GraphFromFasta.cc:1164:30: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />         for (i=0; i bubble_up_cluster_growth(std::map&amp;, std::map&amp;)’:<br />./GraphFromFasta_MPI.cc:706:23: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />     for (int i = 0; i &lt; pool_vec.size(); i++) {<br />                       ^<br />./GraphFromFasta_MPI.cc:727:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />         for (int i = 0; i &lt; pool_vec.size(); i++) {<br />                           ^<br />./GraphFromFasta_MPI.cc:834:23: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />     for (int i = 0; i &lt; pool_vec.size(); i++) {<br />                       ^<br />./GraphFromFasta_MPI.cc: In function ‘void add_unclustered_iworm_contigs(svec&amp;, vecDNAVector&amp;)’:<br />./GraphFromFasta_MPI.cc:1144:30: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />         for (size_t i = 0; i &lt; p.size(); i++) {<br />                              ^<br />./GraphFromFasta_MPI.cc: In function ‘int main(int, char**)’:<br />./GraphFromFasta_MPI.cc:1453:60: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />             if (iworm_counter % 1000 == 0 || iworm_counter == dna.size()-1) {<br />                                                            ^<br />./GraphFromFasta_MPI.cc:1458:24: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />             for (j=0; j&lt;=d.isize()-k; j++) {<br />                        ^<br />./GraphFromFasta_MPI.cc:1479:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />                     if (c == i)<br />                           ^<br />./GraphFromFasta_MPI.cc:1503:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />                     if (c == i)<br />                           ^<br />./GraphFromFasta_MPI.cc:2235:24: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />             for (j=0; j&lt;=d.isize()-k; j++) {<br />                        ^<br />./GraphFromFasta_MPI.cc:2264:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />                     if (c == i) {<br />                           ^<br />./GraphFromFasta_MPI.cc:2359:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />                     if (c == i) {<br />                           ^<br />./GraphFromFasta_MPI.cc:2475:16: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />     for (i=0; i&lt;clustered_pools.isize(); i++) {<br />                ^<br />./GraphFromFasta_MPI.cc:2483:30: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />         for (size_t j = 0; j &lt; p.size(); j++) {<br />                              ^<br />./GraphFromFasta_MPI.cc:2496:30: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />         for (size_t j = 0; j &lt; p.size(); j++) {<br />                              ^<br />/bin/rm -f lib_GraphFromFasta_MPI_temp.a<br />ar -qc  lib_GraphFromFasta_MPI_temp.a obj/GraphFromFasta_MPI.o obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/DeBruijnGraph.o obj/analysis/KmerTable.o obj/analysis/NonRedKmerTable.o obj/analysis/sequenceUtil.o obj/analysis/stacktrace.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./GraphFromFasta_MPI<br />g++ -ggdb3    -fopenmp  -o ./GraphFromFasta_MPI  obj/GraphFromFasta_MPI.o -L. -lm -pthread     -l_GraphFromFasta_MPI_temp<br />/bin/rm lib_GraphFromFasta_MPI_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:53 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/IsoformAugment.cc -o obj/analysis/IsoformAugment.o<br />./analysis/IsoformAugment.cc: In function ‘int main(int, char**)’:<br />./analysis/IsoformAugment.cc:87:16: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />     for (j=0; j&lt;matchesLeft.isize(); j++) {<br />                ^<br />./analysis/IsoformAugment.cc:122:16: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />     for (j=0; j&lt;matches.isize(); j++) {<br />                ^<br />/bin/rm -f lib_IsoformAugment_temp.a<br />ar -qc  lib_IsoformAugment_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/IsoformAugment.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./IsoformAugment<br />g++ -ggdb3    -fopenmp  -o ./IsoformAugment  obj/analysis/IsoformAugment.o -L. -lm -pthread     -l_IsoformAugment_temp<br />/bin/rm lib_IsoformAugment_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:56 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/JoinTransByPairs.cc -o obj/analysis/JoinTransByPairs.o<br />./analysis/JoinTransByPairs.cc: In function ‘int main(int, char**)’:<br />./analysis/JoinTransByPairs.cc:293:14: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />   for (i=0; i&lt;dna.size(); i++) {<br />              ^<br />./analysis/JoinTransByPairs.cc:341:14: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />   for (i=0; i&lt;dna.size(); i++) {<br />              ^<br />/bin/rm -f lib_JoinTransByPairs_temp.a<br />ar -qc  lib_JoinTransByPairs_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/JoinTransByPairs.o obj/analysis/KmerTable.o obj/analysis/NonRedKmerTable.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./JoinTransByPairs<br />g++ -ggdb3    -fopenmp  -o ./JoinTransByPairs  obj/analysis/JoinTransByPairs.o -L. -lm -pthread     -l_JoinTransByPairs_temp<br />/bin/rm lib_JoinTransByPairs_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:28:00 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/QuantifyGraph.cc -o obj/analysis/QuantifyGraph.o<br />/bin/rm -f lib_QuantifyGraph_temp.a<br />ar -qc  lib_QuantifyGraph_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/KmerTable.o obj/analysis/NonRedKmerTable.o obj/analysis/QuantifyGraph.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./QuantifyGraph<br />g++ -ggdb3    -fopenmp  -o ./QuantifyGraph  obj/analysis/QuantifyGraph.o -L. -lm -pthread     -l_QuantifyGraph_temp<br />/bin/rm lib_QuantifyGraph_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:28:03 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/ReadsToTranscripts.cc -o obj/analysis/ReadsToTranscripts.o<br />/bin/rm -f lib_ReadsToTranscripts_temp.a<br />ar -qc  lib_ReadsToTranscripts_temp.a obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/NonRedKmerTable.o obj/analysis/ReadsToTranscripts.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./ReadsToTranscripts<br />g++ -ggdb3    -fopenmp  -o ./ReadsToTranscripts  obj/analysis/ReadsToTranscripts.o -L. -lm -pthread     -l_ReadsToTranscripts_temp<br />/bin/rm lib_ReadsToTranscripts_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:28:09 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./ReadsToTranscripts_MPI.cc -o obj/ReadsToTranscripts_MPI.o<br />/bin/rm -f lib_ReadsToTranscripts_MPI_temp.a<br />ar -qc  lib_ReadsToTranscripts_MPI_temp.a obj/ReadsToTranscripts_MPI.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/NonRedKmerTable.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./ReadsToTranscripts_MPI<br />g++ -ggdb3    -fopenmp  -o ./ReadsToTranscripts_MPI  obj/ReadsToTranscripts_MPI.o -L. -lm -pthread     -l_ReadsToTranscripts_MPI_temp<br />/bin/rm lib_ReadsToTranscripts_MPI_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:28:14 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./ReadsToTranscripts_MPI_chang.cc -o obj/ReadsToTranscripts_MPI_chang.o<br />/bin/rm -f lib_ReadsToTranscripts_MPI_chang_temp.a<br />ar -qc  lib_ReadsToTranscripts_MPI_chang_temp.a obj/ReadsToTranscripts_MPI_chang.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/NonRedKmerTable.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./ReadsToTranscripts_MPI_chang<br />g++ -ggdb3    -fopenmp  -o ./ReadsToTranscripts_MPI_chang  obj/ReadsToTranscripts_MPI_chang.o -L. -lm -pthread     -l_ReadsToTranscripts_MPI_chang_temp<br />/bin/rm lib_ReadsToTranscripts_MPI_chang_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:28:18 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/RunButterfly.cc -o obj/analysis/RunButterfly.o<br />./analysis/RunButterfly.cc: In member function ‘void JobControl::ClearFiles()’:<br />./analysis/RunButterfly.cc:107:25: warning: ignoring return value of ‘int system(const char*)’, declared with attribute warn_unused_result [-Wunused-result]<br />       system(rm.c_str());<br />                         ^<br />./analysis/RunButterfly.cc: In member function ‘void JobControl::Submit()’:<br />./analysis/RunButterfly.cc:77:27: warning: ignoring return value of ‘int system(const char*)’, declared with attribute warn_unused_result [-Wunused-result]<br />    system(theCmmd.c_str());<br />                           ^<br />./analysis/RunButterfly.cc:85:27: warning: ignoring return value of ‘int system(const char*)’, declared with attribute warn_unused_result [-Wunused-result]<br />    system(theCmmd.c_str());   <br />                           ^<br />/bin/rm -f lib_RunButterfly_temp.a<br />ar -qc  lib_RunButterfly_temp.a obj/analysis/RunButterfly.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./RunButterfly<br />g++ -ggdb3    -fopenmp  -o ./RunButterfly  obj/analysis/RunButterfly.o -L. -lm -pthread     -l_RunButterfly_temp<br />/bin/rm lib_RunButterfly_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:28:23 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/TranscriptomeFromVaryK.cc -o obj/analysis/TranscriptomeFromVaryK.o<br />./analysis/TranscriptomeFromVaryK.cc: In function ‘int main(int, char**)’:<br />./analysis/TranscriptomeFromVaryK.cc:216:16: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />     for (j=0; j&lt;=d.lsize()-k; j++) {<br />                ^<br />./analysis/TranscriptomeFromVaryK.cc:218:22: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />       for (int x=j; x&lt;j+k; x++) {<br />                      ^<br />/bin/rm -f lib_TranscriptomeFromVaryK_temp.a<br />ar -qc  lib_TranscriptomeFromVaryK_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/KmerTable.o obj/analysis/NonRedKmerTable.o obj/analysis/TranscriptomeFromVaryK.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./TranscriptomeFromVaryK<br />g++ -ggdb3    -fopenmp  -o ./TranscriptomeFromVaryK  obj/analysis/TranscriptomeFromVaryK.o -L. -lm -pthread     -l_TranscriptomeFromVaryK_temp<br />/bin/rm lib_TranscriptomeFromVaryK_temp.a<br />make[1]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Chrysalis'<br />cd trinity-plugins &amp;&amp; make trinity_essentials<br />make[1]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins'<br />tar xvf seqtk-trinity.v0.0.2.tar.gz<br />seqtk-trinity-0.0.2/<br />seqtk-trinity-0.0.2/.gitignore<br />seqtk-trinity-0.0.2/LICENSE<br />seqtk-trinity-0.0.2/Makefile<br />seqtk-trinity-0.0.2/README.md<br />seqtk-trinity-0.0.2/khash.h<br />seqtk-trinity-0.0.2/kseq.h<br />seqtk-trinity-0.0.2/seqtk.c<br />seqtk-trinity-0.0.2/testing/<br />seqtk-trinity-0.0.2/testing/newformat_1.fq<br />seqtk-trinity-0.0.2/testing/newformat_2.fq<br />seqtk-trinity-0.0.2/testing/oldformat_1.fq<br />seqtk-trinity-0.0.2/testing/oldformat_2.fq<br />cd seqtk-trinity-0.0.2 &amp;&amp; make<br />make[2]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/seqtk-trinity-0.0.2'<br />gcc -g -Wall -O2 -Wno-unused-function seqtk.c -o seqtk-trinity -lz -lm<br />seqtk.c: In function ‘stk_comp’:<br />seqtk.c:444:16: warning: variable ‘lc’ set but not used [-Wunused-but-set-variable]<br />    int la, lb, lc, na, nb, nc, cnt[11];<br />                ^<br />make[2]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/seqtk-trinity-0.0.2'<br />mv seqtk-trinity-0.0.2/seqtk-trinity ./BIN/.<br />tar -zxvf "ParaFly-0.1.0".tar.gz &amp;&amp; \<br />cd "ParaFly-0.1.0" &amp;&amp; sh ./configure --prefix=`pwd` &amp;&amp; make install &amp;&amp; \<br />cp bin/ParaFly ../BIN/<br />ParaFly-0.1.0/<br />ParaFly-0.1.0/LICENSE<br />ParaFly-0.1.0/Makefile<br />ParaFly-0.1.0/Makefile.am<br />ParaFly-0.1.0/Makefile.in<br />ParaFly-0.1.0/README.md<br />ParaFly-0.1.0/aclocal.m4<br />ParaFly-0.1.0/bin/<br />ParaFly-0.1.0/bin/ParaFly<br />ParaFly-0.1.0/config.h<br />ParaFly-0.1.0/config.h.in<br />ParaFly-0.1.0/config.log<br />ParaFly-0.1.0/config.status<br />ParaFly-0.1.0/configure<br />ParaFly-0.1.0/configure.ac<br />ParaFly-0.1.0/depcomp<br />ParaFly-0.1.0/install-sh<br />ParaFly-0.1.0/missing<br />ParaFly-0.1.0/src/<br />ParaFly-0.1.0/src/.deps/<br />ParaFly-0.1.0/src/.deps/ParaFly.Po<br />ParaFly-0.1.0/src/.deps/argProcessor.Po<br />ParaFly-0.1.0/src/Makefile<br />ParaFly-0.1.0/src/Makefile.am<br />ParaFly-0.1.0/src/Makefile.in<br />ParaFly-0.1.0/src/ParaFly.cpp<br />ParaFly-0.1.0/src/argProcessor.cpp<br />ParaFly-0.1.0/src/argProcessor.hpp<br />ParaFly-0.1.0/stamp-h1<br />ParaFly-0.1.0/test/<br />ParaFly-0.1.0/test/Makefile<br />ParaFly-0.1.0/test/cmds.txt<br />ParaFly-0.1.0/test/rand_exit.pl<br />checking for a BSD-compatible install... /usr/bin/install -c<br />checking whether build environment is sane... yes<br />checking for a thread-safe mkdir -p... /bin/mkdir -p<br />checking for gawk... gawk<br />checking whether make sets $(MAKE)... yes<br />checking for g++... g++<br />checking for C++ compiler default output file name... a.out<br />checking whether the C++ compiler works... yes<br />checking whether we are cross compiling... no<br />checking for suffix of executables... <br />checking for suffix of object files... o<br />checking whether we are using the GNU C++ compiler... yes<br />checking whether g++ accepts -g... yes<br />checking for style of include used by make... GNU<br />checking dependency style of g++... gcc3<br />checking for library containing cos... none required<br />configure: creating ./config.status<br />config.status: creating Makefile<br />config.status: creating src/Makefile<br />config.status: creating config.h<br />config.status: config.h is unchanged<br />config.status: executing depfiles commands<br />make[2]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'<br />Making install in src<br />make[3]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/src'<br />g++ -DHAVE_CONFIG_H -I. -I..    -pedantic -fopenmp -Wall -Wextra -Wno-long-long -Wno-deprecated -m64 -g -O2 -MT ParaFly.o -MD -MP -MF .deps/ParaFly.Tpo -c -o ParaFly.o ParaFly.cpp<br />mv -f .deps/ParaFly.Tpo .deps/ParaFly.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -pedantic -fopenmp -Wall -Wextra -Wno-long-long -Wno-deprecated -m64 -g -O2 -MT argProcessor.o -MD -MP -MF .deps/argProcessor.Tpo -c -o argProcessor.o argProcessor.cpp<br />mv -f .deps/argProcessor.Tpo .deps/argProcessor.Po<br />g++ -pedantic -fopenmp -Wall -Wextra -Wno-long-long -Wno-deprecated -m64 -g -O2   -o ParaFly ParaFly.o argProcessor.o  <br />make[4]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/src'<br />test -z "/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/bin" || /bin/mkdir -p "/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/bin"<br />  /usr/bin/install -c ParaFly '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/bin'<br />make[4]: Nothing to be done for 'install-data-am'.<br />make[4]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/src'<br />make[3]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/src'<br />make[3]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'<br />make[4]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'<br />make[4]: Nothing to be done for 'install-exec-am'.<br />make[4]: Nothing to be done for 'install-data-am'.<br />make[4]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'<br />make[3]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'<br />make[2]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'<br />ln -sf Trimmomatic-0.36 Trimmomatic<br />make[1]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins'<br />sh ./util/support_scripts/trinity_install_tests.sh<br />~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~</p>

<p>Performing Unit Tests of Build<br /> <br />~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~<br />Inchworm:                has been Installed Properly<br />Chrysalis:               has been Installed Properly<br />QuantifyGraph:           has been Installed Properly<br />GraphFromFasta:          has been Installed Properly<br />ReadsToTranscripts:      has been Installed Properly<br />parafly:                 has been Installed Properly<br />➜  trinityrnaseq-Trinity-v2.6.6 git:(master) ✗<br />➜  trinityrnaseq-Trinity-v2.6.6 git:(master) ✗ ./Trinity</p>

<p>###############################################################################<br />#</p>

<p>     ______  ____   ____  ____   ____  ______  __ __<br />    |      ||    \ |    ||    \ |    ||      ||  |  |<br />    |      ||  D  ) |  | |  _  | |  | |      ||  |  |<br />    |_|  |_||    /  |  | |  |  | |  | |_|  |_||  ~  |<br />      |  |  |    \  |  | |  |  | |  |   |  |  |___, |<br />      |  |  |  .  \ |  | |  |  | |  |   |  |  |     |<br />      |__|  |__|\_||____||__|__||____|  |__|  |____/</p>

<p>#<br />#<br /># Required:<br />#<br />#  --seqType &lt;string&gt;      :type of reads: ('fa' or 'fq')<br />#<br />#  --max_memory       :suggested max memory to use by Trinity where limiting can be enabled. (jellyfish, sorting, etc)<br />#                            provided in Gb of RAM, ie.  '--max_memory 10G'<br />#<br />#  If paired reads:<br />#      --left      :left reads, one or more file names (separated by commas, no spaces)<br />#      --right     :right reads, one or more file names (separated by commas, no spaces)<br />#<br />#  Or, if unpaired reads:<br />#      --single    :single reads, one or more file names, comma-delimited (note, if single file contains pairs, can use flag: --run_as_paired )<br />#<br />#  Or,<br />#      --samples_file          tab-delimited text file indicating biological replicate relationships.<br />#                                   ex.<br />#                                        cond_A    cond_A_rep1    A_rep1_left.fq    A_rep1_right.fq<br />#                                        cond_A    cond_A_rep2    A_rep2_left.fq    A_rep2_right.fq<br />#                                        cond_B    cond_B_rep1    B_rep1_left.fq    B_rep1_right.fq<br />#                                        cond_B    cond_B_rep2    B_rep2_left.fq    B_rep2_right.fq<br />#<br />#                      # if single-end instead of paired-end, then leave the 4th column above empty.<br />#<br />####################################<br />##  Misc:  #########################<br />#<br />#  --SS_lib_type           :Strand-specific RNA-Seq read orientation.<br />#                                   if paired: RF or FR,<br />#                                   if single: F or R.   (dUTP method = RF)<br />#                                   See web documentation.<br />#<br />#  --CPU                      :number of CPUs to use, default: 2<br />#  --min_contig_length        :minimum assembled contig length to report<br />#                                   (def=200)<br />#<br />#  --long_reads            :fasta file containing error-corrected or circular consensus (CCS) pac bio reads<br />#                                   (** note: experimental parameter **, this functionality continues to be under development)<br />#<br />#  --genome_guided_bam     :genome guided mode, provide path to coordinate-sorted bam file.<br />#                                   (see genome-guided param section under --show_full_usage_info)<br />#<br />#  --jaccard_clip                  :option, set if you have paired reads and<br />#                                   you expect high gene density with UTR<br />#                                   overlap (use FASTQ input file format<br />#                                   for reads).<br />#                                   (note: jaccard_clip is an expensive<br />#                                   operation, so avoid using it unless<br />#                                   necessary due to finding excessive fusion<br />#                                   transcripts w/o it.)<br />#<br />#  --trimmomatic                   :run Trimmomatic to quality trim reads<br />#                                        see '--quality_trimming_params' under full usage info for tailored settings.<br />#                                  <br />#<br />#  --no_normalize_reads            :Do *not* run in silico normalization of reads. Defaults to max. read coverage of 50.<br />#                                       see '--normalize_max_read_cov' under full usage info for tailored settings.<br />#                                       (note, as of Sept 21, 2016, normalization is on by default)<br />#     <br />#  --no_distributed_trinity_exec   :do not run Trinity phase 2 (assembly of partitioned reads), and stop after generating command list.<br />#<br />#<br />#  --output                :name of directory for output (will be<br />#                                   created if it doesn't already exist)<br />#                                   default( your current working directory: "/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity_out_dir" <br />#                                    note: must include 'trinity' in the name as a safety precaution! )<br />#             <br />#  --workdir               :where Trinity phase-2 assembly computation takes place (defaults to --output setting).<br />#                                  (can set this to a node-local drive or RAM disk)     <br />#  <br />#  --full_cleanup                  :only retain the Trinity fasta file, rename as ${output_dir}.Trinity.fasta<br />#<br />#  --cite                          :show the Trinity literature citation<br />#<br />#  --verbose                       :provide additional job status info during the run.<br />#<br />#  --version                       :reports Trinity version (Trinity-v2.6.6) and exits.<br />#<br />#  --show_full_usage_info          :show the many many more options available for running Trinity (expert usage).<br />#<br />#<br />###############################################################################<br />#<br />#  *Note, a typical Trinity command might be:<br />#<br />#        Trinity --seqType fq --max_memory 50G --left reads_1.fq  --right reads_2.fq --CPU 6<br />#<br />#<br />#    and for Genome-guided Trinity:<br />#<br />#        Trinity --genome_guided_bam rnaseq_alignments.csorted.bam --max_memory 50G<br />#                --genome_guided_max_intron 10000 --CPU 6<br />#<br />#     see: /home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/sample_data/test_Trinity_Assembly/<br />#          for sample data and 'runMe.sh' for example Trinity execution<br />#<br />#     For more details, visit: http://trinityrnaseq.github.io<br />#<br />###############################################################################</p>
]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/39469/introduction-to-bioinformatics</guid>
	<pubDate>Wed, 05 Jun 2019 14:58:11 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/39469/introduction-to-bioinformatics</link>
	<title><![CDATA[Introduction to Bioinformatics]]></title>
	<description><![CDATA[<p><img src="https://edu.t-bio.info/wp-content/uploads/2017/07/Introduction-Course-Title-11.jpg" alt="Introduction to Bioinformatics Course" width="600" height="315.6" style="vertical-align: top; border: 0px; border: 0px;"></p><p>Introduction to bioinformatics is a course for biologists and clinicians that would like to learn more about the way bioinformatics is used in healthcare, biotech and pharmaceuitcal industry as well as basic research. The course covers many of the topics transformed by the emergence of big data and computational technologies. To learn more about the course, visit:&nbsp;<a href="https://edu.t-bio.info/course/introduction-bioinformatics/">https://edu.t-bio.info/course/introduction-bioinformatics/</a></p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/31278/metapred2cs</guid>
	<pubDate>Fri, 03 Mar 2017 05:15:07 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/31278/metapred2cs</link>
	<title><![CDATA[MetaPred2CS]]></title>
	<description><![CDATA[<p style="text-align: justify;"><strong>MetaPred2CS Web server&nbsp;</strong>is a meta-predictor based on&nbsp;<a href="http://www.ncbi.nlm.nih.gov/pubmed/17160063">Support Vector Machine (SVM)</a>&nbsp;that combines 6 individual sequence based protein-protein interaction prediction methods to predict&nbsp;<strong>prokaryotic two-component system&nbsp;</strong>protein-protein interactions (PPIs). The methods implemented in MetaPred2CS are 2 co-evolutionary methods:&nbsp;<a href="http://www.ncbi.nlm.nih.gov/pubmed/11933068">in-silico two hybrid (i2h)</a>&nbsp;and&nbsp;<a href="http://www.ncbi.nlm.nih.gov/pubmed/11707606">mirror tree (MT)</a>&nbsp;methods and 4 genomics context based methods:&nbsp;<a href="http://www.ncbi.nlm.nih.gov/pubmed/15947018">phylogenetic profiling (PP)</a>,&nbsp;<a href="http://www.ncbi.nlm.nih.gov/pubmed/10573422">gene fusion (GF)</a>,&nbsp;<a href="http://www.ploscompbiol.org/article/info%3Adoi%2F10.1371%2Fjournal.pcbi.0030043">gene neighbourhood (GN)</a>&nbsp;and and&nbsp;<a href="http://www.ploscompbiol.org/article/info%3Adoi%2F10.1371%2Fjournal.pcbi.0030043">gene operon methods (GO)</a>.</p>
<p>&nbsp;http://metapred2cs.ibers.aber.ac.uk/</p><p>Address of the bookmark: <a href="https://github.com/martinjvickers/MetaPred2CS" rel="nofollow">https://github.com/martinjvickers/MetaPred2CS</a></p>]]></description>
	<dc:creator>Manisha Mishra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/27847/anvio</guid>
	<pubDate>Thu, 16 Jun 2016 18:15:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/27847/anvio</link>
	<title><![CDATA[Anvio]]></title>
	<description><![CDATA[<p>In a nutshell</p>
<p>Anvi&rsquo;o is an analysis and visualization platform for &lsquo;omics data.</p>
<p>Please find the methods paper here: https://peerj.com/articles/1319/</p>
<p>Anvi&rsquo;o would not have been possible without the help of many people who directly or indirectly contributed to its development. Here is the acknowledgements section of our methods paper</p>
<p><span>An analysis and visualization platform for 'omics data</span><span>&nbsp;</span><span><a href="http://merenlab.org/projects/anvio">http://merenlab.org/projects/anvio</a></span></p>
<p><span>Paper&nbsp;https://peerj.com/articles/1839/</span></p><p>Address of the bookmark: <a href="https://github.com/meren/anvio" rel="nofollow">https://github.com/meren/anvio</a></p>]]></description>
	<dc:creator>Shruti Paniwala</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/28199/genome-workbench-2107</guid>
	<pubDate>Fri, 01 Jul 2016 12:09:59 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/28199/genome-workbench-2107</link>
	<title><![CDATA[Genome Workbench 2.10.7]]></title>
	<description><![CDATA[<p>Genome Workbench 2.10.7 is here! New features include added support for local custom BLAST databases and improvements to Tree View.</p><p>For the full list of features, improvements and fixes, see the release notes:<a href="https://ncbi.nlm.nih.gov/tools/gbench/releasenotes" target="_blank">https://ncbi.nlm.nih.gov/tools/gbench/releasenotes</a></p><p>New Features</p><ul>
<li>BLAST Tool: added support for local custom BLAST databases</li>
<li>Graphical Sequence View: added log scaling option for graph tracks</li>
<li>Generic Table View:&nbsp;<a href="https://www.ncbi.nlm.nih.gov/tools/gbench/tutorial17">new tutorial</a>&nbsp;added</li>
</ul><p>Bug Fixes and Improvements</p><ul>
<li>Project Tree View: Genomic Collections/Assemblies now show accessions, not just names</li>
<li>Tree View: layout updated to better accommodate nodes of different sizes</li>
<li>Table Import Dialog (MacOS): fixed issue with table visibility</li>
<li>Fixed bug where different molecules IDs in GenBank could resolve to the same sequence</li>
<li>Graphical Sequence View: fixed issue where sequence track was not shown for some sequences</li>
<li>Graphical Sequence View: fixed protein coloration methods</li>
<li>Graphical Sequence View: improved rendering of Markers to better indicate boundaries and produce higher quality PDF images</li>
<li>Create Gene Model tool: fixed scenario when gene model tool failed with local sequences</li>
<li>Search View: ORF Finder &ndash; fixed incorrect protein lengths</li>
<li>Fixed bug with not opening project file (.gbp) on a click</li>
<li>Fixed issues in GVF import</li>
<li>Fixed BLAST Search tool against NCBI databases not working</li>
<li>Fixed tblastn (protein BLAST) not working in standalone mode</li>
<li>Fixed GTF export failure</li>
</ul>]]></description>
	<dc:creator>Gudiya Pal</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/28415/scarpa</guid>
	<pubDate>Wed, 13 Jul 2016 07:59:25 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/28415/scarpa</link>
	<title><![CDATA[Scarpa]]></title>
	<description><![CDATA[<p><strong>Scarpa</strong>&nbsp;is a stand-alone scaffolding tool for NGS data. It can be used together with virtually any genome assembler and any NGS read mapper that supports SAM format. Other features include support for multiple libraries and an option to estimate insert size distributions from data. Scarpa is available free of charge for academic and commercial use under the GNU General Public License (GPL).</p>
<p>See the&nbsp;<a href="http://compbio.cs.toronto.edu/hapsembler/hapsembler-2.21_manual.pdf">user manual</a>&nbsp;or the&nbsp;<a href="http://compbio.cs.toronto.edu/hapsembler/scarpa_paper.pdf">paper</a>&nbsp;for more information about Scarpa. Click&nbsp;<a href="http://compbio.cs.toronto.edu/hapsembler/ScarpaSupplementary.pdf">here</a>&nbsp;for the supplementary material.</p><p>Address of the bookmark: <a href="http://compbio.cs.toronto.edu/hapsembler/scarpa.html" rel="nofollow">http://compbio.cs.toronto.edu/hapsembler/scarpa.html</a></p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>

</channel>
</rss>