<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/44762?offset=100</link>
	<atom:link href="https://bioinformaticsonline.com/related/44762?offset=100" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/43329/postdoc-position-at-kiel-university-germany</guid>
  <pubDate>Sat, 28 Aug 2021 01:16:55 -0500</pubDate>
  <link></link>
  <title><![CDATA[Postdoc position at Kiel University, Germany]]></title>
  <description><![CDATA[
<p>In the Genomic Microbiology Group of Prof. Tal Dagan at the Institute<br />of Microbiology at Kiel University, Germany, a</p>

<p>Postdoc position (m/w/d)</p>

<p>in the field of computational evolutionary microbiology is available<br />for an initially limited period of 36 months at the earliest possible<br />date. The weekly working time corresponds to 100% of full employment<br />(If the legal requirements under collective bargaining law are met, the<br />tariff grouping is carried out up to pay scale 13 TV-L. The obligation<br />to teach amounts to 4 hours.</p>

<p>The Genomic Microbiology Group research interests are focused on<br />microbial genome evolution with an emphasis on the study of lateral gene<br />transfer. In our research we use both computational and experimental<br />approaches (see www.uni-kiel.de/genomik). The position offers the<br />opportunity to develop an independent research profile within the group<br />research focus. The successful applicant is expected to be involved<br />in teaching of bioinformatics and molecular evolution, including the<br />development of teaching materials (lectures/exercises/short videos).</p>

<p>Your profile:<br />· Doctoral or PhD degree in Molecular Evolution, Bioinformatics or<br />related fields.<br />· Knowledge and experience in programming (e.g., Python) and<br />biostatistical analysis (e.g., with R or MatLab).<br />· Any of the following expertise is an advantage: the analysis of<br />genomic or transcriptomic data, phylogenetic reconstruction,<br />comparative genomics.<br />· Good oral and written communication skills in English.<br />· Ability to teach in German is an advantage (alternatively, an<br />indication to do so from the 2nd year on).<br />· Skills and motivation to communicate and interact with other<br />scientists.<br /> <br />The Christian-Albrechts-University sees itself as a modern and<br />cosmopolitan employer. We welcome your application regardless of your age,<br />gender, cultural and social background, religion, ideology, disability<br />or sexual identity. We promote equality of the sexes.</p>

<p>The Christian-Albrechts-University is committed to the employment of<br />people with disabilities. Preference will be given to applications from<br />severely handicapped persons and persons of equal standing, provided<br />they are suitable.</p>

<p>We expressly welcome applications from people with a migration background.</p>

<p>For enquiries regarding the position, teaching obligations and research<br />topic please contact Prof. Tal Dagan: tdagan@ifam.uni-kiel.de.</p>

<p>Applications should be submitted by email to Mrs. Haacks<br />(dhaacks@ifam.uni-kiel.de) as a single PDF and include: (1) a letter of<br />motivation (max 1 page, Arial 11, line spacing 1.15), (2) CV, (3) PhD<br />certificate. Please use 'GMG postdoc application - [your name]'<br />as a subject.</p>

<p>Please, refrain from sending us application photos.</p>

<p>Application deadline:  August 31 2021 or until the position is<br />filled. Interviews will take place during September/October 2021. The<br />planned starting date for the position is flexible (but in 2021).</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/10262/research-fellow-phd-candidate-in-computational-biology-%E2%80%93-2-positions</guid>
  <pubDate>Fri, 25 Apr 2014 20:19:58 -0500</pubDate>
  <link></link>
  <title><![CDATA[Research fellow (PhD candidate) in computational biology – 2 positions]]></title>
  <description><![CDATA[
<p>At the Department of Informatics two 4-year positions as research fellow are available in the field of computational biology connected to the Computational Biology Unit. The positions are linked to the project “Integrated genomics - linking transcriptional and translational regulation over developmental time” supported by the Bergen Research Foundation</p>

<p>The fate of a cell is ultimately the product of the regulation of its genes. Gene regulation is a coordinated process acting at multiple levels of which transcription and translation are the most prominent. The Valen group is dedicated to the fundamental question of how transcription and translation is integrated to obtain the desired protein abundance. The recent development of high-throughput next generation sequencing techniques to monitor both active translation and transcription has made it possible to study this connection at the genome scale.</p>

<p>This project aims to elucidate the links between regulation of translation and transcription. The applicant will analyze next generation sequencing data and model gene regulation on a genome-wide level to identify the features that affect the translational output of transcripts. The work will be done in close collaboration with experimental scientists who will test the predictions of the computational models.</p>

<p>Additional information on the position can be obtained by contacting Eivind Valen (eivind.valen@ii.uib.no).</p>

<p>The research fellow must take part in the University’s approved PhD program leading to the degree within a time limit of 3 years. Application for admission to the PhD program, including a project plan outline for the training module, will be worked out in collaboration with the research group in question.</p>

<p>In total, the fellowship period is 4 years, 25 % of this will be allocated to teaching and/or administrative duties. The fellowship period may be reduced if the successful applicant has held previous employment as a research fellow or similar.</p>

<p>http://www.jobbnorge.no/en/available-jobs/job/102235/research-fellow-phd-candidate-in-computational-biology-2-positions</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44472/pipesnake-bioinformatics-best-practice-analysis-pipeline-for-phylogenomic-reconstruction</guid>
	<pubDate>Wed, 21 Feb 2024 06:19:41 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44472/pipesnake-bioinformatics-best-practice-analysis-pipeline-for-phylogenomic-reconstruction</link>
	<title><![CDATA[pipesnake: bioinformatics best-practice analysis pipeline for phylogenomic reconstruction]]></title>
	<description><![CDATA[<p dir="auto"><span>ausarg/pipesnake</span>&nbsp;is a bioinformatics best-practice analysis pipeline for phylogenomic reconstruction starting from short-read 'second-generation' sequencing data.</p>
<p dir="auto">The pipeline is built using&nbsp;<a href="https://www.nextflow.io/">Nextflow</a>, a workflow tool to run tasks across multiple compute infrastructures in a very portable manner. It uses Docker/Singularity containers making installation trivial and results highly reproducible. The&nbsp;<a href="https://www.nextflow.io/docs/latest/dsl2.html">Nextflow DSL2</a>&nbsp;implementation of this pipeline uses one container per process which makes it much easier to maintain and update software dependencies.</p><p>Address of the bookmark: <a href="https://github.com/AusARG/pipesnake" rel="nofollow">https://github.com/AusARG/pipesnake</a></p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/10415/bioinformatician-stuck-in-wet-lab</guid>
	<pubDate>Tue, 06 May 2014 12:46:56 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/10415/bioinformatician-stuck-in-wet-lab</link>
	<title><![CDATA[Bioinformatician stuck in wet-lab]]></title>
	<description><![CDATA[<p>This guide is aimed at pet bioinformaticians, and is meant to guide them towards better career development.</p>
<p><strong>1. Make friends with local bioinformatics groups</strong><br> <strong>2. Talk to your computing group</strong><br> <strong>3. Obtain clear expectations</strong><br> <strong>4. Rewrite your job description</strong><br> <strong>5. Papers</strong><br> <strong>6. Attend bioinformatics meetings</strong><br> <strong>7. Try first, ask later</strong></p><p>Address of the bookmark: <a href="http://biomickwatson.wordpress.com/2013/04/23/a-guide-for-the-lonely-bioinformatician/" rel="nofollow">http://biomickwatson.wordpress.com/2013/04/23/a-guide-for-the-lonely-bioinformatician/</a></p>]]></description>
	<dc:creator>Rahul Agarwal</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/44930/bioinformatics-the-bridge-between-curiosity-and-discovery</guid>
	<pubDate>Mon, 24 Nov 2025 05:16:49 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/44930/bioinformatics-the-bridge-between-curiosity-and-discovery</link>
	<title><![CDATA[Bioinformatics: The Bridge Between Curiosity and Discovery]]></title>
	<description><![CDATA[<p>In the sprawling universe of modern science, bioinformatics stands as one of the most transformative and empowering fields of our time. It is where biology meets computation, where data becomes meaning, and where curiosity becomes discovery. If you&rsquo;ve stepped into this world&mdash;or are considering it&mdash;here&rsquo;s your reminder: you&rsquo;re part of a revolution.</p><p><strong>Why Bioinformatics Matters More Than Ever</strong></p><p>Every day, our world generates massive amounts of biological data&mdash;from genome sequences to microbiome profiles to real-time pathogen surveillance. Hidden within these datasets are the answers to some of the greatest challenges humanity faces: emerging diseases, antimicrobial resistance, environmental stress, genetic disorders, sustainable agriculture, and more.</p><p>Bioinformatics isn&rsquo;t just a skill.<br />It&rsquo;s the language of the future of biology.</p><p>By mastering it, you give yourself the power to:</p><p>Decode genomes and understand life at its most fundamental level</p><p>Identify patterns no microscope could ever reveal</p><p>Predict disease outbreaks before they occur</p><p>Accelerate drug discovery with computational precision</p><p>Contribute to open-source tools that empower scientists worldwide</p><p>You don&rsquo;t just follow science&mdash;you drive it.</p><p><strong>Every Expert Was Once a Beginner</strong></p><p>Many newcomers feel intimidated. Command-line interfaces. R scripts. Python packages. Next-generation sequencing data. Complex machine learning models.</p><p>But here&rsquo;s the truth: every bioinformatician started exactly where you are now&mdash;curious, unsure, but excited.</p><p>No one writes perfect code on day one.</p><p>No one understands genomics pipelines immediately.</p><p>What makes you a bioinformatician is not perfection, but perseverance.</p><p>When your script throws a cryptic error&hellip;<br />When your data refuses to format&hellip;<br />When your pipeline runs for 6 hours only to crash&hellip;</p><p>Remember: this is part of the journey.<br />Every error teaches you. Every retry strengthens you. Every breakthrough energizes you.</p><p>Bioinformatics Is Not Just a Career&mdash;It&rsquo;s a Mindset</p><p>It&rsquo;s the mindset of:</p><p>Problem-solving.</p><p>Continuous learning.</p><p>Turning chaos into clarity.</p><p>Seeing what others can&rsquo;t.</p><p>Bioinformaticians are detectives of biological complexity. You sit at the intersection of innovation, using tools that can shape public health, medicine, agriculture, and ecology. Few fields give you such direct impact on the world.</p><p><strong>Your Contribution Matters</strong></p><p>As you work on your script, pipeline, genome, or model, remember:</p><p>Somewhere, your analysis might contribute to:</p><p>A new therapy</p><p>A faster diagnostic test</p><p>A better understanding of a pathogen</p><p>A more resilient crop</p><p>An open-source dataset that helps thousands</p><p>A discovery that rewrites textbooks</p><p>Your code may be small, but its ripple effect is powerful.</p><p>The Future Is Bioinformatics&mdash;And You Are Part of It</p><p>The world is shifting. Wet labs are integrating AI. Hospitals rely on genomic insights. Farmers use gene-level predictions. Governments monitor disease in real time. Students launch pipelines that become global tools.</p><p>This is a golden era&mdash;and you are not late.<br />You are exactly where you need to be.</p><p>Keep Pushing. Keep Learning. Keep Discovering.</p><p>Bioinformatics is a journey filled with challenges, but also with unmatched rewards.</p><p>So the next time you feel stuck, frustrated, or overwhelmed, remember:<br />You&rsquo;re building the science of tomorrow.</p><p>Be proud. Stay curious. Keep going.<br />Your work matters more than you think.</p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/10881/special-project-scientist-%E2%80%93-sorghum-genomics</guid>
  <pubDate>Tue, 20 May 2014 00:34:39 -0500</pubDate>
  <link></link>
  <title><![CDATA[Special Project Scientist – Sorghum Genomics]]></title>
  <description><![CDATA[
<p>ICRISAT is seeking applications from Indian Nationals for a Special Project Scientist to work on a sorghum genomics activities related to sequencing/re-sequencing projects utilizing New Generation Sequencing platforms.</p>

<p>The Job detail</p>

<p>    Advancing the SNP-discovery and polymorphism assessment work across several germplasm panels representing global genetic diversity<br />    Population genetic and genomic analyses, testing the hypothesis related to adaptation in multiple geographic regions<br />    Develop SNP assays from large scale GBS and other re-sequencing data for several target traits utilizing available phenotyping data<br />    Combined analyses of genotypic and phenotypic data for discovery of marker-trait associations, and conducting GWAS<br />    Processing, analyzing, and archiving large-scale genomic data sets, assessing data quality, conducting analyses, interpreting findings, and communicating findings to others including preparation of reports, presentations, posters and journal articles<br />    Providing support to MSc and PhD students on topic related to its major core of research<br />    Any other work assigned by the supervisor</p>

<p>The Person:</p>

<p>    PhD in bioinformatics, genetics, computational biology preferably with 1 to 2 years of experience;<br />    familiar with standard bioinformatics tools and scripting languages and emerging and evolving software platforms relevant to bioinformatics and computational biology;<br />    ability to create new analytical pipelines; experience with handling large data sets;<br />    ability to program in at least two of the following: C++, PERL, Python, R, Java.<br />    will use next-generation sequencing technologies to generate marker data for genetic mapping and transcriptome data for expression QTL mapping, and will be responsible for data generation as well as data analysis.</p>

<p>Period and Remuneration: The assignment is for a period of two years, and can be extended for another year depending on performance. ICRISAT pays a very attractive all inclusive lump sum assignment fee payable in Indian Rupees.</p>

<p>How to Apply: Please send your application by email to icrisatjobs@cgiar.org, stating the job title (Special project Scientist-Sorghum Genomics) clearly in the subject column, addressed to the Director, Human Resources and Operations, ICRISAT, Patancheru, Andhra Pradesh 502 324, India, latest by 10 June 2014. The application should include an up-to-date Curriculum Vitae, a short statement of competencies and experience for the position, and the names and addresses (including phone/e-mail) of three referees. Only short-listed candidates will be contacted.</p>

<p>More at: http://www.icrisat.org/careers/Special-Project-Scientist-Sorghum-Genomics.htm</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43101/luigi-a-python-package-that-helps-you-build-complex-pipelines-of-batch-jobs</guid>
	<pubDate>Thu, 24 Jun 2021 05:43:31 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43101/luigi-a-python-package-that-helps-you-build-complex-pipelines-of-batch-jobs</link>
	<title><![CDATA[Luigi: a Python package that helps you build complex pipelines of batch jobs.]]></title>
	<description><![CDATA[<p>Luigi is a Python (3.6, 3.7, 3.8, 3.9 tested) package that helps you build complex pipelines of batch jobs. It handles dependency resolution, workflow management, visualization, handling failures, command line integration, and much more.</p>
<p>Run <code>pip install luigi</code> to install the latest stable version from <a href="https://pypi.python.org/pypi/luigi">PyPI</a>. <a href="https://luigi.readthedocs.io/en/stable/">Documentation for the latest release</a> is hosted on readthedocs.</p>
<p>Run <code>pip install luigi[toml]</code> to install Luigi with <a href="https://luigi.readthedocs.io/en/stable/configuration.html">TOML-based configs</a> support.</p><p>Address of the bookmark: <a href="https://github.com/spotify/luigi" rel="nofollow">https://github.com/spotify/luigi</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/10739/science-for-life-laboratory-scilifelab-sweden</guid>
  <pubDate>Sat, 10 May 2014 06:22:30 -0500</pubDate>
  <link></link>
  <title><![CDATA[Science for Life Laboratory (SciLifeLab)-Sweden]]></title>
  <description><![CDATA[
<p>Science for Life Laboratory (SciLifeLab) is a national center for molecular biosciences with focus on health and environmental research. The center combines frontline technical expertise with advanced knowledge of translational medicine and molecular bioscience. SciLifeLab is a national resource and a collaboration between four universities: Karolinska Institutet, KTH Royal Institute of Technology, Stockholm University and Uppsala University.</p>

<p>Webpage : https://www.scilifelab.se/about-us/<br />Opportunity: https://www.scilifelab.se/about-us/career/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/44709/a-step-by-step-guide-to-running-blast-offline</guid>
	<pubDate>Sat, 07 Dec 2024 22:32:37 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/44709/a-step-by-step-guide-to-running-blast-offline</link>
	<title><![CDATA[A Step-by-Step Guide to Running BLAST Offline]]></title>
	<description><![CDATA[<p>BLAST (Basic Local Alignment Search Tool) is a powerful algorithm used to compare nucleotide or protein sequences to sequence databases, identifying regions of similarity. Running BLAST offline provides more control, ensures data security, and allows customization for specific research needs. Here&rsquo;s a detailed guide to set up and run BLAST locally on your system.</p><hr><h3>Step 1: <strong>Install BLAST</strong></h3><ol>
<li>
<p><strong>Download BLAST</strong>:</p>
<ul>
<li>Visit the <a href="https://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/LATEST/">NCBI BLAST+ download page</a> to download the appropriate version for your operating system (Windows, macOS, or Linux).</li>
</ul>
</li>
<li>
<p><strong>Install BLAST</strong>:</p>
<ul>
<li>Extract the downloaded archive. For Linux/Mac, use:
<pre><code>tar -xvzf ncbi-blast-*.tar.gz
cd ncbi-blast-*
</code></pre>
</li>
<li>Add the BLAST binary folder to your system PATH for easier access:
<pre><code>export PATH=$PATH:/path/to/ncbi-blast-*/bin
</code></pre>
</li>
</ul>
</li>
<li>
<p><strong>Verify Installation</strong>:<br /> Run the following command to ensure BLAST is installed correctly:</p>
<pre><code>blastn -version
</code></pre>
</li>
</ol><hr><h3>Step 2: <strong>Prepare a Local Database</strong></h3><p>To run BLAST offline, you&rsquo;ll need a sequence database.</p><ol>
<li>
<p><strong>Download a Pre-Built Database (Optional)</strong>:</p>
<ul>
<li>NCBI provides ready-to-use databases such as <code>nt</code>, <code>nr</code>, and <code>Swiss-Prot</code>. Use the <code>update_blastdb.pl</code> script (bundled with BLAST) to download these:
<pre><code>update_blastdb.pl --decompress nt
</code></pre>
</li>
</ul>
</li>
<li>
<p><strong>Create a Custom Database</strong>:<br /> If you have specific sequences to use as a database:</p>
<ul>
<li>Prepare a FASTA file containing the sequences.</li>
<li>Use <code>makeblastdb</code> to create a database:
<pre><code>makeblastdb -in your_sequences.fasta -dbtype [nucl|prot] -out custom_db
</code></pre>
Replace <code>[nucl|prot]</code> with <code>nucl</code> for nucleotide sequences or <code>prot</code> for protein sequences.</li>
</ul>
</li>
</ol><hr><h3>Step 3: <strong>Prepare the Query Sequence</strong></h3><ul>
<li>Save your query sequence(s) in FASTA format.</li>
<li>Ensure the file is properly formatted, with a header line starting with <code>&gt;</code> followed by the sequence name, and the sequence on subsequent lines.</li>
</ul><p>Example:</p><pre><code>&gt;query_sequence
ATGCGTAGCTAGCGTAGCTAGCTAGCTA
</code></pre><hr><h3>Step 4: <strong>Run BLAST</strong></h3><ol>
<li>
<p><strong>Choose the Appropriate BLAST Tool</strong>:<br /> Depending on your data type:</p>
<ul>
<li><strong>blastn</strong>: For nucleotide-nucleotide searches.</li>
<li><strong>blastp</strong>: For protein-protein searches.</li>
<li><strong>blastx</strong>: Translates nucleotide sequences into proteins and compares them to a protein database.</li>
<li><strong>tblastn</strong>: Compares protein sequences to a nucleotide database.</li>
<li><strong>tblastx</strong>: Translates both nucleotide query and database sequences.</li>
</ul>
</li>
<li>
<p><strong>Run the Command</strong>:<br /> Example command for <code>blastn</code>:</p>
<pre><code>blastn -query query.fasta -db custom_db -out results.txt -outfmt 6 -evalue 1e-5
</code></pre>
<p><strong>Explanation of Parameters</strong>:</p>
<ul>
<li><code>-query</code>: Specifies the query file.</li>
<li><code>-db</code>: Points to the local database.</li>
<li><code>-out</code>: Output file name.</li>
<li><code>-outfmt</code>: Output format (e.g., 6 for tabular format).</li>
<li><code>-evalue</code>: E-value cutoff for significance.</li>
</ul>
</li>
</ol><hr><h3>Step 5: <strong>Interpret Results</strong></h3><ol>
<li>
<p><strong>Output Formats</strong>:</p>
<ul>
<li><strong>Default (outfmt 0)</strong>: Human-readable format.</li>
<li><strong>Tabular (outfmt 6)</strong>: Includes fields like query ID, subject ID, percent identity, alignment length, etc.</li>
</ul>
</li>
<li>
<p><strong>Analyze Results</strong>:<br /> Use tools like <code>grep</code>, Python, or R to parse and filter results for downstream analysis.</p>
</li>
</ol><hr><h3>Step 6: <strong>Optimize Performance</strong></h3><p>For large datasets, BLAST can be resource-intensive. To improve performance:</p><ol>
<li>
<p><strong>Multithreading</strong>:<br /> Use the <code>-num_threads</code> option to leverage multiple CPU cores:</p>
<pre><code>blastn -query query.fasta -db custom_db -out results.txt -num_threads 4
</code></pre>
</li>
<li>
<p><strong>Database Subsetting</strong>:<br /> Split large databases into smaller chunks for faster searches.</p>
</li>
<li>
<p><strong>Adjust Parameters</strong>:</p>
<ul>
<li>Lower the <code>-evalue</code> threshold for stricter matches.</li>
<li>Use <code>-max_target_seqs</code> to limit the number of results per query.</li>
</ul>
</li>
</ol><hr><h3>Step 7: <strong>Update Databases (Optional)</strong></h3><p>If using NCBI databases, regularly update them to ensure the inclusion of the latest sequences:</p><pre><code>update_blastdb.pl --decompress nt
</code></pre><hr><h3>Conclusion</h3><p>Running BLAST offline is a straightforward process that offers flexibility and security for bioinformaticians working with sensitive data. By following this guide, you can harness the power of BLAST to analyze sequences efficiently and gain valuable biological insights.</p><p>For advanced use cases, explore BLAST&rsquo;s customization options, such as custom scoring matrices, filtering, and iterative searches with tools like PSI-BLAST. Happy BLASTing!</p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/10841/ra-at-iisr-kozhikode</guid>
  <pubDate>Thu, 15 May 2014 10:08:09 -0500</pubDate>
  <link></link>
  <title><![CDATA[RA at IISR Kozhikode]]></title>
  <description><![CDATA[
<p>INDIAN INSTITUTE OF SPICES RESEARCH<br />(Indian Council of Agricultural Research)<br />Marikunnu P.O., Kozhikode – 673 012, Kerala</p>

<p>Walk- in- Test cum Interview (based on test) for the selection of Research Associate</p>

<p>under the scheme “Distributed Information Sub Centre –DISC” &amp; Research Assistant under scheme “Phytophthora, Fusarium and Ralstonia diseases of Horticultural and Field Crops” will be held at this Institute as per details indicated below.</p>

<p>WALK -IN- TEST CUM INTERVIEW</p>

<p>Name of the post : Research Associate</p>

<p>Date of Interview : 21-05-2014 at 10.00 AM</p>

<p>No. of posts : One</p>

<p>Qualifications : a)Essential</p>

<p>Ph.D Degree in Bioinformatics OR :  Masters degree in Bioinformatics with a minimum of<br />60% marks or equivalent OGPA with at least two years research experience as evidenced from fellowship/ associateship/training/published papers etc.</p>

<p>b)Desirable: Experience in NGS data analysis.</p>

<p>Emoluments : Rs. 23,000/- per month + HRA (Masters Degree Holders)</p>

<p>Rs. 24,000/- per month + HRA (Ph.D Degree Holders)</p>

<p>Upper age limit : 40 years for Men &amp; 45 years for Women as on date of Interview (Upper Age limits are relaxable for SC, ST and OBC candidates as per Govt. of India norms (at present 5 years for SC/ST and 3 years for OBC)</p>

<p>Duration of Project : Till 31-03-2017.</p>

<p>Title of Assigment : Research Assistant (on contract basis)</p>

<p>No. of vacancy : One</p>

<p>Qualification : Essential : Post Graduation in Bioinformatics and  Minimum one year experience in NGS data analysis</p>

<p>Desirable : Experience in Perl/Python/R</p>

<p>Remuneration : Rs. 20,000/- per month (consolidated)</p>

<p>Scope of work :</p>

<p>1. Analysis of different file formats and their conversions.</p>

<p>2. Assessing the quality of data and filtering of raw reads.<br />3. Assembling the raw reads-de novo as well as reference  mapping.<br />4. Compression of aligned reads using Jam tools<br />5. RNA-seq. Analysis<br />6. Differential expression testing involving Normalization,  Statistical testing, heat map generation &amp; hierarchical  clustering<br />7. Annotating the assembled genome and geneet testing  and their validation<br />8. Metabolic pathway analysis<br />9. Comparative genomics<br />10. Setting up of genome browsers.</p>

<p>Period of Assigment : Initially for six months.</p>

<p>Date &amp; Venue of Interview : 21-05-2014 at IISR, Kozhikode at 10.00 AM</p>

<p>More at http://www.spices.res.in/pdf/disc-advtmnt.pdf</p>
]]></description>
</item>

</channel>
</rss>