More at https://github.com/ekg/glia

glia -f ~/human_g1k_v37.fasta -t 20:62900077-62902077 -v variants.vcf.gz \
     -s AAATGTAAACATTTTATAGGGGATTCCCCTAAAAACAAAAAAACTTTCTGGGAAAGATTTTTCAAAAAATAAAA

Address of the bookmark: https://github.com/ekg/glia

Scientist and entrepreneur Morten Sommer will talk about how bacteria and microbes form an integral part of the human body and play a significant role in controlling human health and well About TEDx, x = independently organized event: In the spirit of ideas worth spreading, TEDx is a program of local, self-organized events that bring people together to share a TED-like experience. At a TEDx event, TEDTalks video and live speakers combine to spark deep discussion and connection in a small group. These local, self-organized events are branded TEDx, where x = independently organized TED event. The TED Conference provides general guidance for the TEDx program, but individual TEDx events are self-organized.* (*Subject to certain rules and regulations)

https://github.com/jennomics/WorkflowPaper/blob/master/Genome%20Assembly%20and%20Annotation.md

Address of the bookmark: http://bioinformatics.uconn.edu/bacterial-genome-assembly-tutorial/

Address of the bookmark: https://www.kegg.jp/blastkoala/

What is Bacterial Comparative Genomics?

Comparative genomics involves the systematic comparison of genomes across different bacterial species or strains. This approach allows scientists to:

• Identify conserved and unique genes.

• Explore genetic determinants of pathogenicity.

• Understand bacterial evolution and phylogenetics.

• Investigate horizontal gene transfer and its role in antibiotic resistance.

Bioinformatics is central to these analyses, enabling the processing and interpretation of large-scale genomic data.

Key Steps in Bacterial Comparative Genomics

1. Genome Sequencing and Assembly: The process begins with obtaining high-quality bacterial genome sequences. Advances in next-generation sequencing (NGS) technologies have made it faster and more affordable to sequence bacterial genomes. Tools such as SPAdes and Velvet are commonly used for genome assembly.

2. Genome Annotation: Annotating a genome involves identifying genes, regulatory elements, and other genomic features. Automated tools like Prokka and RAST provide functional annotations, allowing researchers to predict the roles of genes and proteins.

3. Genome Alignment: Aligning genomes is crucial for identifying conserved regions, single-nucleotide polymorphisms (SNPs), and structural variations. Tools like Mauve and progressiveMauve are commonly employed for whole-genome alignments.

4. Comparative Analyses:

   • Core and Pan-genome Analysis: The core genome consists of genes shared across all strains of a species, while the pan-genome includes all genes found in any strain. Software like Roary and BPGA can perform core and pan-genome analyses.

   • Phylogenetic Analysis: Comparative genomics often involves reconstructing evolutionary relationships. Tools such as MEGA and IQ-TREE facilitate phylogenetic tree construction based on genomic data.

   • Functional Enrichment Analysis: To understand the biological significance of unique or shared genes, functional enrichment analysis using databases like GO (Gene Ontology) and KEGG is essential.

Here are some additional bioinformatics tools that can aid bacterial comparative genomics:

• OrthoFinder: For accurate ortholog identification across multiple genomes.

• PanOCT: Specifically designed for pan-genome clustering and annotation.

• FASTANI: A tool for calculating Average Nucleotide Identity (ANI) for microbial genome comparisons.

• CIRCOS: For visually comparing genomic data through circular genome plots.

• Galaxy Platform: A user-friendly web-based platform offering numerous genomic analysis tools.

• BLAST: Essential for sequence alignment and similarity searches.

• PhyloSift: Focused on phylogenetic analysis of microbial genomes using marker genes.

These tools, in combination with the methods discussed, provide a robust framework for conducting comprehensive comparative genomic studies.

Applications of Bacterial Comparative Genomics

1. Understanding Pathogenicity: Comparative genomics helps identify virulence factors that distinguish pathogenic strains from non-pathogenic relatives. For instance, comparing genomes of Escherichia coli strains has revealed key genetic determinants of pathogenicity in enterohemorrhagic strains.

2. Antibiotic Resistance Research: The spread of antibiotic resistance genes through horizontal gene transfer is a major global concern. Comparative analyses can trace the origins and dissemination of resistance genes, aiding in the development of countermeasures.

3. Microbial Ecology and Evolution: By studying genomic variations, researchers can understand how bacteria adapt to different environments. This is particularly relevant for extremophiles and symbiotic bacteria.

4. Vaccine Development: Identifying conserved antigens across pathogenic strains is critical for vaccine design. Comparative genomics has been instrumental in developing vaccines against pathogens like Neisseria meningitidis.

5. Biotechnology Applications: Comparative studies can uncover unique metabolic pathways in bacteria, paving the way for applications in bioremediation, synthetic biology, and industrial microbiology.

Challenges in Bacterial Comparative Genomics

While the field has made significant strides, several challenges remain:

• Data Overload: The rapid growth of sequencing data requires robust computational infrastructure and efficient algorithms.

• Genome Plasticity: High rates of horizontal gene transfer and genome rearrangements in bacteria complicate comparative analyses.

• Annotation Accuracy: Automated annotation tools are not infallible, and manual curation is often needed for high-confidence results.

• Interpreting Non-Coding Regions: Understanding the functional significance of non-coding genomic regions remains a challenge.

Future Directions

The integration of bacterial comparative genomics with other ‘omics’ approaches—such as transcriptomics, proteomics, and metabolomics—promises a more comprehensive understanding of bacterial biology. Additionally, advancements in machine learning and artificial intelligence are likely to further enhance bioinformatics analyses, enabling the prediction of complex phenotypes from genomic data.

Conclusion

Bacterial comparative genomics, driven by bioinformatics, continues to unravel the complexities of bacterial life. From combating antibiotic resistance to uncovering the secrets of microbial evolution, this interdisciplinary field holds immense potential for addressing pressing challenges in microbiology and beyond. As technology advances, so too will our ability to harness the power of comparative genomics for scientific and societal benefit.

https://fhs.mcmaster.ca/gupta-lab/index.html

Grouping large genomic fragments assembled from shotgun metagenomic sequences to deconvolute complex microbial communities, or metagenome binning, enables the study of individual organisms and their interactions. Here we developed an automated metagenome binning software, called MetaBAT, which integrates empirical probabilistic distances of genome abundance and tetranucleotide frequency. Tested on both synthetic and real metagenome datasets, MetaBAT outperforms alternative methods in both accuracy and computational efficiency. Applying MetaBAT to an assembly from 1,704 human gut samples formed 1,634 genome bins (>200kb) in 3 hours, where 621 genome bins are >50% complete with <5% contamination from other species. Further analysis shows that the quality of these genome bins approaches manually curated genomes.

Address of the bookmark: https://bitbucket.org/berkeleylab/metabat

Address of the bookmark: https://sourceforge.net/projects/taxoblast/files/

Address of the bookmark: https://github.com/CSB5/INC-Seq

Address of the bookmark: https://github.com/bcgsc/ARCS/