BOL: Related items

Multi-metagenome assembly

Radha Agarkar — Fri, 03 Mar 2017 10:14:18 -0600

This project contains scripts and tutorials on how to assemble individual microbial genomes from metagenomes, as described in:

Genome sequences of rare, uncultured bacteria obtained by differential coverage binning of multiple metagenomes

Mads Albertsen, Philip Hugenholtz, Adam Skarshewski, Gene W. Tyson, Kåre L. Nielsen and Per .H. Nielsen

Nature Biotechnology 2013, doi: 10.1038/nbt.2579

Address of the bookmark: https://github.com/MadsAlbertsen/multi-metagenome

LoRDEC: a hybrid error correction program for long, PacBio reads

Jit — Mon, 10 Apr 2017 04:16:09 -0500

LoRDEC is a program to correct sequencing errors in long reads from 3rd generation sequencing with high error rate, and is especially intended for PacBio reads. It uses a hybrid strategy, meaning that it uses two sets of reads: the reference read set, whose error rate is assumed to be small, and the PacBio read set, which is then corrected using the reference set. Typically, the reference set contains Illumina reads.

Usually, errors in PacBio reads include many insertions and deletions, and comparatively less substitutions. LoRDEC can correct errors of all these types.
After correction, a larger portion of the sequence of PacBio reads is usable for detection of region of similarity with other sequences, for aligning them to the contigs of an assembly, etc.

Why is LoRDEC different?

It is efficient and can process large read data sets, included from eukaryotic or vertebrate species, on a usual computing server, and even works on desktop/laptop computers.
It adopts a novel graph based approach: it builds a succinct De Bruijn Graph (DBG) representing the short reads, and seeks a corrective sequence for each erroneous region of a long read by traversing chosen paths in the graph.

Address of the bookmark: http://www.atgc-montpellier.fr/lordec/

Jabba: Hybrid Error Correction for Long Sequencing Reads

Jit — Fri, 05 Jan 2018 03:58:14 -0600

Jabba is a hybrid error correction tool to correct third generation (PacBio / ONT) sequencing data, using second generation (Illumina) data.

Input

Jabba takes as input a concatenated de Bruijn graph and a set of sequences:

the de Bruijn graph should appear in fasta format with 1 entry per node, the meta information should be in the format:
>NODE
the set of sequences should be in fasta or fastq format. These sequences will be corrected (e.g. PacBio reads). The corrections will be written to a file Jabba fasta.
The output is a file in fasta format with corrections of the long reads, and additionally a file in the input format containing uncorrected reads.

https://github.com/biointec/jabba/wiki

https://almob.biomedcentral.com/articles/10.1186/s13015-016-0075-7

Address of the bookmark: https://github.com/biointec/jabba

QuorUM: An Error Corrector for Illumina Reads

BioStar — Tue, 04 Feb 2020 23:26:55 -0600

We produce trimmed and error-corrected reads that result in assemblies with longer contigs and fewer errors. We compared QuorUM against several published error correctors and found that it is the best performer in most metrics we use. QuorUM is efficiently implemented making use of current multi-core computing architectures and it is suitable for large data sets (1 billion bases checked and corrected per day per core)

Address of the bookmark: http://www.genome.umd.edu/

Common steps for reads mapping !

BioStar — Thu, 09 Mar 2023 02:48:02 -0600

Mapping reads to a reference genome is an essential step in many types of genomic analysis, such as variant calling and gene expression analysis. Here are some general steps to follow for mapping reads to a genome:

Choose a read mapper: There are many read mappers available, such as BWA, Bowtie, and HISAT2. Choose a mapper that is appropriate for your type of data and research question.
Index the reference genome: Before mapping reads, the reference genome needs to be indexed. This involves creating an index of the genome sequence that allows the mapper to quickly find matches to the reads. Most mappers have their own indexing tools.
Prepare the read data: The reads should be in a format that is compatible with the mapper. Most mappers accept FASTQ or BAM files. Depending on the quality of the data, it may need to be filtered or trimmed before mapping.
Run the mapper: The mapper is run with the command-line interface or using a graphical user interface. The specific command depends on the mapper being used, but typically involves specifying the input data, reference genome, and output file format.
Evaluate the mapping results: After the mapping is complete, the results should be evaluated. This includes assessing the quality of the mapping, such as the mapping rate, the number of mapped reads, and the mapping quality score.
Post-processing: Depending on the analysis being performed, post-processing of the mapped reads may be necessary. This can include filtering reads based on quality, removing duplicate reads, and calling variants.

Overall, mapping reads to a reference genome is a complex process that requires careful consideration of the type of data, the research question, and the specific mapper being used.

Glia: a Graph/Smith-Waterman (partial order) aligner/realigner

Jit — Tue, 28 Jan 2020 04:02:58 -0600

glia's main use is as a local realigner. It will realign reads to a set of known (or putative) variants in a VCF, both consuming and producing an ordered stream of BAM alignments.

More at https://github.com/ekg/glia

glia -f ~/human_g1k_v37.fasta -t 20:62900077-62902077 -v variants.vcf.gz \
     -s AAATGTAAACATTTTATAGGGGATTCCCCTAAAAACAAAAAAACTTTCTGGGAAAGATTTTTCAAAAAATAAAA

Address of the bookmark: https://github.com/ekg/glia

TEDxCopenhagen - Morten Sommer - What Bacteria Means for the Good Life

Wed, 13 Aug 2014 05:07:19 -0500

Scientist and entrepreneur Morten Sommer will talk about how bacteria and microbes form an integral part of the human body and play a significant role in controlling human health and well About TEDx, x = independently organized event: In the spirit of ideas worth spreading, TEDx is a program of local, self-organized events that bring people together to share a TED-like experience. At a TEDx event, TEDTalks video and live speakers combine to spark deep discussion and connection in a small group. These local, self-organized events are branded TEDx, where x = independently organized TED event. The TED Conference provides general guidance for the TEDx program, but individual TEDx events are self-organized.* (*Subject to certain rules and regulations)

Bacterial genome assembly !!

Jit — Fri, 05 May 2017 06:11:22 -0500

This tutorial will serve as an example of how to use free and open-source genome assembly and secondary scaffolding tools to generate high quality assemblies of bacterial sequence data. The bacterial sample used in this tutorial will be referred to simply as “Species” since it is live data. This data is paired-end data, meaning that there are forward and reverse reads, which we will designate as Sample_R1.fastq and Sample_R2.fastq, respectively.

https://github.com/jennomics/WorkflowPaper/blob/master/Genome%20Assembly%20and%20Annotation.md

Address of the bookmark: http://bioinformatics.uconn.edu/bacterial-genome-assembly-tutorial/

KOALA: KEGG's internal annotation tool for K number assignment of KEGG GENES using SSEARCH computation

Abhimanyu Singh — Wed, 12 Dec 2018 09:16:55 -0600

KOALA (KEGG Orthology And Links Annotation) is KEGG's internal annotation tool for K number assignment of KEGG GENES using SSEARCH computation. BlastKOALA and GhostKOALA assign K numbers to the user's sequence data by BLAST and GHOSTX searches, respectively, against a nonredundant set of KEGG GENES. Annotate Sequence in KEGG Mapper and Pathogen Checker in KEGG Pathogen are special interfaces to the BlastKOALA server and can be executed in an interactive mode. See Step-by-step Instructions.

Reference: Kanehisa, M., Sato, Y., and Morishima, K. (2016) BlastKOALA and GhostKOALA: KEGG tools for functional characterization of genome and metagenome sequences. J. Mol. Biol. 428, 726-731. [pubmed] [pdf]

Address of the bookmark: https://www.kegg.jp/blastkoala/

Exploring Bacterial Comparative Genomics: A Bioinformatics Approach

LEGE — Sat, 14 Dec 2024 12:31:14 -0600

In the world of microbiology, bacteria have long fascinated scientists for their diversity, adaptability, and crucial roles in ecosystems and human health. Comparative genomics—a field that involves analyzing and comparing the genomes of different organisms—has revolutionized our understanding of bacterial evolution, adaptation, and pathogenicity. By leveraging bioinformatics tools and techniques, researchers can uncover genomic insights that were once hidden. This blog delves into the principles, methodologies, and applications of bacterial comparative genomics from a bioinformatics perspective.

What is Bacterial Comparative Genomics?

Comparative genomics involves the systematic comparison of genomes across different bacterial species or strains. This approach allows scientists to:

Identify conserved and unique genes.
Explore genetic determinants of pathogenicity.
Understand bacterial evolution and phylogenetics.
Investigate horizontal gene transfer and its role in antibiotic resistance.

Bioinformatics is central to these analyses, enabling the processing and interpretation of large-scale genomic data.

Key Steps in Bacterial Comparative Genomics

Genome Sequencing and Assembly: The process begins with obtaining high-quality bacterial genome sequences. Advances in next-generation sequencing (NGS) technologies have made it faster and more affordable to sequence bacterial genomes. Tools such as SPAdes and Velvet are commonly used for genome assembly.
Genome Annotation: Annotating a genome involves identifying genes, regulatory elements, and other genomic features. Automated tools like Prokka and RAST provide functional annotations, allowing researchers to predict the roles of genes and proteins.
Genome Alignment: Aligning genomes is crucial for identifying conserved regions, single-nucleotide polymorphisms (SNPs), and structural variations. Tools like Mauve and progressiveMauve are commonly employed for whole-genome alignments.
Comparative Analyses:
- Core and Pan-genome Analysis: The core genome consists of genes shared across all strains of a species, while the pan-genome includes all genes found in any strain. Software like Roary and BPGA can perform core and pan-genome analyses.
- Phylogenetic Analysis: Comparative genomics often involves reconstructing evolutionary relationships. Tools such as MEGA and IQ-TREE facilitate phylogenetic tree construction based on genomic data.
- Functional Enrichment Analysis: To understand the biological significance of unique or shared genes, functional enrichment analysis using databases like GO (Gene Ontology) and KEGG is essential.

Recommended Bioinformatics Tools for Comparative Genomics

Here are some additional bioinformatics tools that can aid bacterial comparative genomics:

OrthoFinder: For accurate ortholog identification across multiple genomes.
PanOCT: Specifically designed for pan-genome clustering and annotation.
FASTANI: A tool for calculating Average Nucleotide Identity (ANI) for microbial genome comparisons.
CIRCOS: For visually comparing genomic data through circular genome plots.
Galaxy Platform: A user-friendly web-based platform offering numerous genomic analysis tools.
BLAST: Essential for sequence alignment and similarity searches.
PhyloSift: Focused on phylogenetic analysis of microbial genomes using marker genes.

These tools, in combination with the methods discussed, provide a robust framework for conducting comprehensive comparative genomic studies.

Applications of Bacterial Comparative Genomics

Understanding Pathogenicity: Comparative genomics helps identify virulence factors that distinguish pathogenic strains from non-pathogenic relatives. For instance, comparing genomes of Escherichia coli strains has revealed key genetic determinants of pathogenicity in enterohemorrhagic strains.
Antibiotic Resistance Research: The spread of antibiotic resistance genes through horizontal gene transfer is a major global concern. Comparative analyses can trace the origins and dissemination of resistance genes, aiding in the development of countermeasures.
Microbial Ecology and Evolution: By studying genomic variations, researchers can understand how bacteria adapt to different environments. This is particularly relevant for extremophiles and symbiotic bacteria.
Vaccine Development: Identifying conserved antigens across pathogenic strains is critical for vaccine design. Comparative genomics has been instrumental in developing vaccines against pathogens like Neisseria meningitidis.
Biotechnology Applications: Comparative studies can uncover unique metabolic pathways in bacteria, paving the way for applications in bioremediation, synthetic biology, and industrial microbiology.

Challenges in Bacterial Comparative Genomics

While the field has made significant strides, several challenges remain:

Data Overload: The rapid growth of sequencing data requires robust computational infrastructure and efficient algorithms.
Genome Plasticity: High rates of horizontal gene transfer and genome rearrangements in bacteria complicate comparative analyses.
Annotation Accuracy: Automated annotation tools are not infallible, and manual curation is often needed for high-confidence results.
Interpreting Non-Coding Regions: Understanding the functional significance of non-coding genomic regions remains a challenge.

Future Directions

The integration of bacterial comparative genomics with other ‘omics’ approaches—such as transcriptomics, proteomics, and metabolomics—promises a more comprehensive understanding of bacterial biology. Additionally, advancements in machine learning and artificial intelligence are likely to further enhance bioinformatics analyses, enabling the prediction of complex phenotypes from genomic data.

Conclusion

Bacterial comparative genomics, driven by bioinformatics, continues to unravel the complexities of bacterial life. From combating antibiotic resistance to uncovering the secrets of microbial evolution, this interdisciplinary field holds immense potential for addressing pressing challenges in microbiology and beyond. As technology advances, so too will our ability to harness the power of comparative genomics for scientific and societal benefit.