BOL: Related items

RopeBWT2: Incremental construction of FM-index for DNA sequences

Rahul Nayak — Thu, 25 Oct 2018 04:48:54 -0500

RopeBWT2 is an tool for constructing the FM-index for a collection of DNA sequences. It works by incrementally inserting one or multiple sequences into an existing pseudo-BWT position by position, starting from the end of the sequences. This algorithm can be largely considered a mixture of BCR and dynamic FM-index. Nonetheless, ropeBWT2 is unique in that it may implicitlysort the input into reverse lexicographical order (RLO) or reverse-complement lexicographical order (RCLO) while building the index.

Address of the bookmark: https://github.com/lh3/ropebwt2

Graph Genome Suite

Jit — Fri, 28 Oct 2016 07:59:54 -0500

Seven Bridges is the biomedical data analysis company accelerating breakthroughs in genomics research for cancer, drug development and precision medicine. We build self-improving systems to analyze millions of genomes, including the Graph Genome Suite — the most advanced population genomics tools in the world.

Address of the bookmark: https://www.sbgenomics.com/graph/

Rectangle Graph for Repeat Resolution in Genome Assembly

Rahul Nayak — Thu, 28 Dec 2017 09:43:03 -0600

Ultimate tool for resolving repeats in genome assemblies.

Though the specific implementation of the idea of the rectangle graph approach is already included into the current SPAdes distribution, we're also releasing the Rectangle Graph Module (RGM) as the separate code which can be run independently of SPAdes. Although RGM differs from the current implementation of the rectangle graph approach in SPAdes, in the future we plan to integrate RGM in SPAdes. RGM can be run with other genome assemblers if they use the graph format as SPAdes files.

For more details see: Nikolay Vyahhi, Son K. Pham, Pavel Pevzner. From de Bruijn Graphs to Rectangle Graphs for Genome Assembly, Lecture Notes in Bioinformatics 7534 (2012), pp. 249-261.

Address of the bookmark: http://bioinf.spbau.ru/en/rectangles

Glia: a Graph/Smith-Waterman (partial order) aligner/realigner

Jit — Tue, 28 Jan 2020 04:02:58 -0600

glia's main use is as a local realigner. It will realign reads to a set of known (or putative) variants in a VCF, both consuming and producing an ordered stream of BAM alignments.

More at https://github.com/ekg/glia

glia -f ~/human_g1k_v37.fasta -t 20:62900077-62902077 -v variants.vcf.gz \
     -s AAATGTAAACATTTTATAGGGGATTCCCCTAAAAACAAAAAAACTTTCTGGGAAAGATTTTTCAAAAAATAAAA

Address of the bookmark: https://github.com/ekg/glia

MEGAHIT: an ultra-fast single-node solution for large and complex metagenomics assembly via succinct de Bruijn graph

Jit — Wed, 14 Nov 2018 04:50:27 -0600

MEGAHIT is a single node assembler for large and complex metagenomics NGS reads, such as soil. It makes use of succinct de Bruijn graph (SdBG) to achieve low memory assembly. MEGAHIT can optionally utilize a CUDA-enabled GPU to accelerate its SdBG contstruction. The GPU-accelerated version of MEGAHIT has been tested on NVIDIA GTX680 (4G memory) and Tesla K40c (12G memory) with CUDA 5.5, 6.0 and 6.5. MEGAHIT v1.0 or greater also supports IBM Power PC and has been tested on IBM POWER8.

https://academic.oup.com/bioinformatics/article/31/10/1674/177884

Address of the bookmark: https://github.com/voutcn/megahit

Panacus : A Counting Tool for Pangenome Graphs

Neel — Fri, 14 Jun 2024 14:42:28 -0500

panacus is a tool for calculating statistics for GFA files. It supports GFA files with P and W lines, but requires that the graph is blunt, i.e., nodes do not overlap and consequently, each link (L) points from the end of one segment (S) to the start of another.

panacus supports the following calculations:

coverage histogram
pangenome growth statistics
path-/group-resolved coverage table

Address of the bookmark: https://github.com/marschall-lab/panacus

AlignGraph: algorithm for secondary de novo genome assembly guided by closely related references

Manisha Mishra — Tue, 17 Apr 2018 16:21:20 -0500

AlignGraph is a software that extends and joins contigs or scaffolds by reassembling them with help provided by a reference genome of a closely related organism.

Using AlignGraph

AlignGraph --read1 reads_1.fa --read2 reads_2.fa --contig contigs.fa --genome genome.fa --distanceLow distanceLow --distanceHigh distancehigh --extendedContig extendedContigs.fa --remainingContig remainingContigs.fa [--kMer k --insertVariation insertVariation --coverage coverage --part p --fastMap --ratioCheck --iterativeMap --misassemblyRemoval --resume]

Address of the bookmark: https://github.com/baoe/AlignGraph

Hercules: a profile HMM-based hybrid error correction algorithm for long reads

Jit — Mon, 20 Aug 2018 14:14:11 -0500

Choosing whether to use second or third generation sequencing platforms can lead to trade-offs between accuracy and read length. Several studies require long and accurate reads including de novo assembly, fusion and structural variation detection. In such cases researchers often combine both technologies and the more erroneous long reads are corrected using the short reads. Current approaches rely on various graph based alignment techniques and do not take the error profile of the underlying technology into account. Memory- and time- efficient machine learning algorithms that address these shortcomings have the potential to achieve better and more accurate integration of these two technologies. Results: We designed and developed Hercules, the first machine learning-based long read error correction algorithm. The algorithm models every long read as a profile Hidden Markov Model with respect to the underlying platformtextquoterights error profile. The algorithm learns a posterior transition/emission probability distribution for each long read and uses this to correct errors in these reads. Using datasets from two DNA-seq BAC clones (CH17-157L1 and CH17-227A2), and human brain cerebellum polyA RNA-seq, we show that Hercules-corrected reads have the highest mapping rate among all competing algorithms and highest accuracy when most of the basepairs of a long read are covered with short reads. Availability:

Hercules source code is available at https://github.com/BilkentCompGen/Hercules

Address of the bookmark: https://github.com/BilkentCompGen/Hercules

HDOCK SERVER

Neel — Tue, 16 Jun 2020 01:54:41 -0500

HDOCK SERVER

Protein-protein and protein-DNA/RNA docking based on a hybrid algorithm of template-based modeling and ab initio free docking.

The HDOCK server distinguishes itself from similar docking servers in its ability to support amino acid sequences as input and a hybrid docking strategy in which experimental information about the protein–protein binding site and small-angle X-ray scattering can be incorporated during the docking and post-docking processes.

Address of the bookmark: http://hdock.phys.hust.edu.cn/

NCBI PSI-BLAST Tutorial

Fri, 23 Aug 2013 02:25:02 -0500

http:--www.biotechnology.jhu.edu- Tutorial for PSI-BLAST, an extension of BLAST that uses matrix algebra. BLAST is a cornerstone bioinformatics tool at NCBI. BLAST is the Basic Local Alignment Search tool and will protein and DNA sequences that are related to a sequence that the user provides.