Ryan M Layer, Colby Chiang, Aaron R Quinlan, and Ira M Hall. 2014. "LUMPY: a Probabilistic Framework for Structural Variant Discovery." Genome Biology 15 (6): R84. doi:10.1186/gb-2014-15-6-r84.

More at https://github.com/arq5x/lumpy-sv

Address of the bookmark: https://github.com/arq5x/lumpy-sv

Careful encoding of graph entities allows odgi to efficiently compute and transform pangenomes with minimal overheads. odgi implements a dynamic data structure that leveraged multi-core CPUs and can be updated on the fly.

The edges and path steps are recorded as deltas between the current node id and the target node id, where the node id corresponds to the rank in the global array of nodes. Graphs built from biological data sets tend to have local partial order and, when sorted, the deltas be small. This allows them to be compressed with a variable length integer representation, resulting in a small in-memory footprint at the cost of packing and unpacking.

The RAM and computational savings are substantial. In partially ordered regions of the graph, most deltas will require only a single byte.

Address of the bookmark: https://github.com/pangenome/odgi

More at http://bioinform.github.io/breakseq2/

Download BreakSeq2

Latest version: https://github.com/bioinform/breakseq2/archive/2.2.tar.gz

For other versions, see "releases". https://github.com/bioinform/breakseq2/releases

Address of the bookmark: http://bioinform.github.io/breakseq2/

Address of the bookmark: http://seqmule.openbioinformatics.org/en/latest/

• nodes, which are labeled by sequences and ids
• edges, which connect two nodes via either of their respective ends
• paths, describe genomes, sequence alignments, and annotations (such as gene models and transcripts) as walks through nodes connected by edges

Address of the bookmark: https://github.com/vgteam/vg

Hagfish requires a reference sequence and a paired end re-sequencing data set. Hagfish has more power the larger the insert size of the paired end library is.

Quick links: Installation,Operation, Read mappers, Hagfish scripts, Hagfish plots

Address of the bookmark: https://github.com/mfiers/hagfish

With Single Molecule, Real-Time (SMRT) Sequencing, you can access structural variations having a broad range of sizes, types, and GC content with the ability to:

• Uncover missing heritability linked to structural variation
• Unambiguously identify genomic context and variant breakpoints at the sequence level to unravel the genetic etiology of disease
• Resolve structural variation across the complete size spectrum with basepair resolution

Following are the SV tools, which can assist you to achieve your goal.

Sniffles: Structural variation caller using third generation sequencing

Sniffles is a structural variation caller using third generation sequencing (PacBio or Oxford Nanopore). It detects all types of SVs using evidence from split-read alignments, high-mismatch regions, and coverage analysis. Please note the current version of Sniffles requires sorted output from BWA-MEM (use -M and -x parameter) or NGM-LR with the optional SAM attributes enabled! 

More at https://github.com/fritzsedlazeck/Sniffles

MultiBreak-SV: It identifies structural variants from next-generation paired end data, third-generation long read data, or data from a combination of sequencing platforms.

There are two pieces of software in this release: (1) a pre-processor that takes machineformat (.m5) BLASR files, and (2) MultiBreak-SV. For installation and usage instructions, see doc/MultiBreakSV-Manual.txt.

More at https://github.com/raphael-group/multibreak-sv

Parliament: A Structural Variation Tool. Why ask a single sv-detection approach to find every variant when you can have a parliament of tools deciding?

Publication about the algorithm and “…the first long-read characterization of structural variation in a diploid human personal genome…” (HS1011) - “Assessing structural variation in a personal genome—towards a human reference diploid genome”

More at https://sourceforge.net/projects/parliamentsv/

https://www.dnanexus.com/papers/Parliament_Info_Sheet.pdf

PBHoney: the structural variation discovery tool 

PBHoney is an implementation of two variant-identification approaches designed to exploit the high mappability of long reads (i.e., greater than 10,000 bp). PBHoney considers both intra-read discordance and soft-clipped tails of long reads to identify structural variants.

Read The Paper http://www.biomedcentral.com/1471-2105/15/180/abstract

More at https://sourceforge.net/projects/pb-jelly/

SMRT-SV: Structural variant and indel caller for PacBio reads

Structural variant (SV) and indel caller for PacBio reads based on methods from Chaisson et al. 2014.

SMRT-SV provides an official software package for tools described in Chaisson et al. 2014 and adds several key features including the following.

• Unified variant calling user interface with built-in cluster compute support
• Small indel calling (2-49 bp)
• Improved inversion calling (screenInversions)
• Quality metric for SV calls based on number of local assemblies supporting each call
• Higher sensitivity for SV calls using tiled local assemblies across the entire genome instead of "signature" regions
• Genotyping of SVs with Illumina paired-end reads from WGS samples

More at https://github.com/EichlerLab/pacbio_variant_caller

Address of the bookmark: https://www.sbgenomics.com/graph/

Though the specific implementation of the idea of the rectangle graph approach is already included into the current SPAdes distribution, we're also releasing the Rectangle Graph Module (RGM) as the separate code which can be run independently of SPAdes. Although RGM differs from the current implementation of the rectangle graph approach in SPAdes, in the future we plan to integrate RGM in SPAdes. RGM can be run with other genome assemblers if they use the graph format as SPAdes files.

For more details see: Nikolay Vyahhi, Son K. Pham, Pavel Pevzner. From de Bruijn Graphs to Rectangle Graphs for Genome Assembly, Lecture Notes in Bioinformatics 7534 (2012), pp. 249-261.

Address of the bookmark: http://bioinf.spbau.ru/en/rectangles

More at https://github.com/ekg/glia

glia -f ~/human_g1k_v37.fasta -t 20:62900077-62902077 -v variants.vcf.gz \
     -s AAATGTAAACATTTTATAGGGGATTCCCCTAAAAACAAAAAAACTTTCTGGGAAAGATTTTTCAAAAAATAAAA

Address of the bookmark: https://github.com/ekg/glia