Local installation:

You can install Ribbon locally from Github by following the instructions here: https://github.com/MariaNattestad/Ribbon

Address of the bookmark: http://genomeribbon.com/

Following are the genome assembly tools based on string graph:

1.SGA (String Graph Assembler) https://github.com/jts/sga

Assembles large genomes from high coverage short read data. SGA is designed as a modular set of programs, which are used to form an assembly pipeline. SGA implements a set of assembly algorithms based on the FM-index. As the FM-index is a compressed data structure, the algorithms are very memory efficient. The SGA assembly has three distinct phases. The first phase corrects base calling errors in the reads. The second phase assembles contigs from the corrected reads. The third phase uses paired end and/or mate pair data to build scaffolds from the contigs. The output of this software is a PDF report that allows the properties of the genome and data quality to be visually explored. By providing more information to the user at the start of an assembly project, this software will help increase awareness of the factors that make a given assembly easy or difficult, assist in the selection of software and parameters and help to troubleshoot an assembly if it runs into problems.

2. SAGE: String-overlap Assembly of GEnomes https://github.com/lucian-ilie/SAGE2

SAGE, for de novo genome assembly. As opposed to most assemblers, which are de Bruijn graph based, SAGE uses the string-overlap graph. SAGE builds upon great existing work on string-overlap graph and maximum likelihood assembly, bringing an important number of new ideas, such as the efficient computation of the transitive reduction of the string overlap graph, the use of (generalized) edge multiplicity statistics for more accurate estimation of read copy counts, and the improved use of mate pairs and min-cost flow for supporting edge merging. The assemblies produced by SAGE for several short and medium-size genomes compared favourably with those of existing leading assemblers.

3. FSG: Fast String Graph

The new integrated assembler has been assessed on a standard benchmark, showing that fast string graph (FSG) is significantly faster than SGA while maintaining a moderate use of main memory, and showing practical advantages in running FSG on multiple threads. Moreover, we have studied the effect of coverage rates on the running times.

4.  BASE https://github.com/dhlbh/BASE

It enhances the classic seed-extension approach by indexing the reads efficiently to generate adaptive seeds that have high probability to appear uniquely in the genome. Such seeds form the basis for BASE to build extension trees and then to use reverse validation to remove the branches based on read coverage and paired-end information, resulting in high-quality consensus sequences of reads sharing the seeds. Such consensus sequences are then extended to contigs. BASE is a practically efficient tool for constructing contig, with significant improvement in quality for long NGS reads. It is relatively easy to extend BASE to include scaffolding.

5. Fermi https://github.com/lh3/fermi/

Fermi is a de novo assembler with a particular focus on assembling Illumina short sequence reads from a mammal-sized genome. In addition to the role of a typical assembler, fermi also aims to preserve heterozygotes which are often collapsed by other assemblers. Its ultimate goal is to find a minimal set of unitigs to represent all the information in raw reads.

If you want to learn about String Graph assembler, please read the following papers -

i) The Fragment Assembly String Graph - E. W. Myers

This paper describes the String Graph concept.

ii) Efficient construction of an assembly string graph using the FM-index - Jared T. Simpson and Richard Durbin

This earlier paper from Simpson and Durbin

iii) Efficient de novo assembly of large genomes using compressed data structures - Jared T. Simpson and Richard Durbin

https://alitvteam.github.io/AliTV/

Address of the bookmark: https://github.com/AliTVTeam/AliTV

if you map reads to GRCh38 or hg38, use the following:

ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/001/405/GCA_000001405.15_GRCh38/seqs_for_alignment_pipelines.ucsc_ids/GCA_000001405.15_GRCh38_no_alt_analysis_set.fna.gz

There are several other versions of GRCh37/GRCh38. What’s wrong with them? Here are a collection of potential issues:

More at http://lh3.github.io/2017/11/13/which-human-reference-genome-to-use

Address of the bookmark: http://lh3.github.io/2017/11/13/which-human-reference-genome-to-use

https://www.nature.com/articles/nmeth.4432

Address of the bookmark: https://github.com/xiaochuanle/MECAT

➜ bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i
➜ bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory
compilation terminated.
➜ bloomfilter git:(master) ✗ cd swig
➜ swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
In file included from BloomFilter_wrap.cxx:1877:0:
../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:
../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]
fread(&header, sizeof(struct FileHeader), 1, file);
^
➜ swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3
➜ swig git:(master) ✗ cd ..
➜ bloomfilter git:(master) ✗ cd ..
➜ lib git:(master) ✗ cd ..
➜ bin git:(master) ✗ ./LINKS
Usage: ./LINKS [v1.8.6]
-f sequences to scaffold (Multi-FASTA format, required)
-s file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)
-m MPET reads (default -m 1 = yes, default = no, optional)
! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s
! Paired MPET reads in their original outward orientation <- -> must be separated by ":"
>template_name
ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC
-d distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)
Multiple distances are separated by comma. eg. -d 500,1000,2000,3000
-k k-mer value (default -k 15, optional)
-t step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)
Multiple steps are separated by comma. eg. -t 10,5
-o offset position for extracting k-mer pairs (default -o 0, optional)
-e error (%) allowed on -d distance e.g. -e 0.1 == distance +/- 10% (default -e 0.1, optional)
-l minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)
-a maximum link ratio between two best contig pairs (default -a 0.3, optional)
*higher values lead to least accurate scaffolding*
-z minimum contig length to consider for scaffolding (default -z 500, optional)
-b base name for your output files (optional)
-r Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)
NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE
IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)
-p Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)
-x Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)
-v Runs in verbose mode (-v 1 = yes, default = no, optional)

Error: Missing mandatory options -f and -s.

ERROR fixed

perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr

Quickstart

http://nanopolish.readthedocs.io/en/latest/quickstart_consensus.html

Algorithms

http://simpsonlab.github.io/2017/06/30/nanopolish-v0.7.0/

Address of the bookmark: https://github.com/jts/nanopolish

download swgis v2.0

Address of the bookmark: http://eugi.bi.up.ac.za/eugi_download_swgis.php

Features

• Linear representation of several segments of DNA
• Comparisons represented by areas between the segments (like Artemis, for example)
• Reads from common formats: Genbank, EMBL, blast, Mauve, and from user-generated tab files
• Plot several subsegments of the same segment on the same line, separated by a //
• Automatic or manual placement of the segments on the plot
• Add annotations to all the lines
• Create smart, automatic annotations for genomes, based on gene names
• Add a user-generated tree
• Add a global scale or a scale to each line
• Use user-defined graphical functions to represent genes

Address of the bookmark: http://genoplotr.r-forge.r-project.org/