<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/45169?offset=20</link>
	<atom:link href="https://bioinformaticsonline.com/related/45169?offset=20" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/3952/ancestor-at-work</guid>
	<pubDate>Sun, 25 Aug 2013 19:45:28 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/3952/ancestor-at-work</link>
	<title><![CDATA[Ancestor at work !!!]]></title>
	<description><![CDATA[<p>When they will learn Bioinformatics :)</p>]]></description>
	<dc:creator>Jit</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/3952" length="10064" type="image/gif" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/fun/view/9207/biogeek-fun</guid>
	<pubDate>Sun, 16 Mar 2014 06:33:31 -0500</pubDate>
	<link>https://bioinformaticsonline.com/fun/view/9207/biogeek-fun</link>
	<title><![CDATA[BioGeek Fun]]></title>
	<description><![CDATA[<p>1. A futuristic computational biology student was told to write "It is in my gene!!!" on the board 100 times as a punishment. here's his response -<br /><br />use warnings;<br />for ($count=1; $count &lt;=100; $count++) { print "It is in my gene!!!";}<br /><br />I guess, he is gonna to be a real biogeek. Nice try though. Smart kid.</p><p>&nbsp;</p><p>2. In some perl script I found this <br />&nbsp;. . . . . .<br />&nbsp;. . . . . .<br /># It works for me, only God understood how it is working<br />while (/(&lt;\/[^&gt;]+&gt;)|(&lt;[^&gt;]+&gt;)|(&lt;[^&gt;]+&gt;)$|([^&gt;&lt;]+)/go) {<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; $startGene=$1;<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; $beginChromosome=$2;<br />&nbsp;&nbsp; &nbsp;<br />. . . . . .<br />&nbsp;.. . . . . .<br />}</p><p>&nbsp;</p><p>3. One more interesting message in Perl found &hellip;. It will must tickle you bone :) <br />open(my $fh, "&lt;", "gene.txt")&nbsp;&nbsp; &nbsp;or kill " Me if you think this is a mistake :$!";<br /><br /></p><p>&nbsp;</p><p>4. From the Perl <br /><br />&nbsp; while () {&nbsp; # "The Mothership Connection is here!"<br />&nbsp;&nbsp; &nbsp;print &ldquo;$_\n&rdquo;; # Printing the offspring :)</p><p>&nbsp;</p><p>5. Perl message<br />if ($1) { print &ldquo;Just found a the error in chromosome !!!, yahoo&hellip;&rdquo;; else { &ldquo;That is not error, but mutation you moron!&rdquo;;</p><p>&nbsp;</p><p>6. One genome database curator walk in wine bar asked the bartender:<br />CREATE TABLE gene IF NOT EXISTS SexOnTheBeach;</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/fun/view/44845/a-bioinformatician%E2%80%99s-lament</guid>
	<pubDate>Thu, 29 May 2025 01:33:31 -0500</pubDate>
	<link>https://bioinformaticsonline.com/fun/view/44845/a-bioinformatician%E2%80%99s-lament</link>
	<title><![CDATA[A Bioinformatician’s Lament]]></title>
	<description><![CDATA[<div><div dir="auto"><p><em>"I have a presentation tomorrow,"</em>&nbsp;they say,</p><p>With hopeful eyes, like it&rsquo;s all child's play.<br />As if results bloom overnight, full-grown&mdash;<br />Not wrangled from chaos, and error-prone.</p><p><strong>Oh brave soul, sit, let&rsquo;s walk through the tale,</strong><br />Of pipelines broken and servers that fail.<br />The journey starts: &ldquo;The data? It&rsquo;s there&mdash;<br />Just fetch it from S3, easy, I swear.&rdquo;</p><p>Now I summon&nbsp;<code>awscli</code>&nbsp;with dread,<br />Reset my keys, credentials fed.<br />Configure regions, IAM roles too&mdash;<br />All this, and still no peek at the view.</p><p>Next up, the tool: &ldquo;It&rsquo;s open source!&rdquo;<br />On GitHub, rotting, no sign of remorse.<br />Python 2.7, some GCC trick&mdash;<br />The install alone might make you sick.</p><p>Finally, progress! The pipeline runs&hellip;<br />Till RAM collapses and error stuns.<br />Oh, and the metadata? A crime,<br />Merged cells, font soup, out of time.</p><p>Sample IDs&mdash;what a cryptic game:<br /><code>Sample_1</code>,&nbsp;<code>S1</code>,&nbsp;<code>sample-1</code>... the same?<br />Controls mislabeled, cases flipped,<br />No wonder my sanity's starting to slip.</p><p>Then QC plots, PCA joy&mdash;<br />Wait, that&rsquo;s a tumor labeled as a boy?<br />Clusters cross, and axes lie,<br />And I still don&rsquo;t know&nbsp;<em>which</em>&nbsp;sample&rsquo;s "guy."</p><p>But the clock ticks on, and it&rsquo;s half-past doom,<br />They want the final UMAP soon.<br />With pastel colors, labeled clear&mdash;<br />"Can we move that legend to&nbsp;<em>right here</em>?"</p><p>Tweak by tweak, I adjust each frame,<br />Resize Panel B, annotate a name.<br />Export the plot&mdash;it starts to gleam&hellip;<br />Then my laptop crashes. I scream.</p><p>This is the grind, the long-haul game,<br />Where science hides behind code and flame.<br />No &ldquo;Export to Nature&rdquo; button to press,<br />Just toil and logic and hope for success.</p><p>So next time you whisper that fated line&mdash;<br />&ldquo;I have a talk, can you make it shine?&rdquo;<br />Know: bioinformatics is craft, not a click,<br />It&rsquo;s science with scars, not just a quick fix.</p><p><strong>To all who debug at 3AM light,</strong><br />Who ghostwrite figures through sleepless night&mdash;<br />You are the backbone, silent and true,<br />First-author-worthy, if only they knew.<br /><br /></p><hr><p><em><br />"कल मेरी प्रेज़ेंटेशन है,"</em>&nbsp;वो कहते हैं,</p></div></div><div><div dir="auto"><p>आशा भरी आँखों से, जैसे सब सहज है।<br />जैसे परिणाम रातोंरात प्रकट हो जाएं&mdash;<br />ना कि डेटा की भूलभुलैया से उखाड़े जाएं।</p><p><strong>आओ बैठो, एक किस्सा सुनाता हूँ,</strong><br />जहाँ पाइपलाइन टूटती है, और सर्वर भी थक जाते हैं।<br />कहानी शुरू होती है: &ldquo;डेटा तो है&mdash;<br />बस S3 बकेट में, एकदम पास में कहीं।&rdquo;</p><p>अब&nbsp;<code>awscli</code>&nbsp;बुलाता हूँ डरते हुए,<br />कुंजी सेट करूँ, क्रेडेंशियल जोड़ूं, रीजन भरूँ।<br />इतनी मशक्कत, फिर भी डेटा नहीं मिला,<br />बस सेटअप में ही पूरा दिन चला।</p><p>फिर आता है टूल: &ldquo;ओपन-सोर्स है!&rdquo;<br />GitHub पर है, 2019 से सूखा पड़ा है।<br />Python 2.7 चाहिए, एक पुराना कम्पाइलर,<br />और साथ में थोड़ी सी दुआ की ताकत।</p><p>आख़िरकार टूल चला, खुशी सी हुई,<br />लेकिन रन करते ही, मेमोरी ने हार मानी।<br />और मेटाडेटा? एक एक्सेल की आफ़त,<br />मर्ज़ किए हुए सेल, बस और क्या चाहिए काफ़ियत?</p><p>सैंपल आईडी? बस भगवान ही जाने&mdash;<br /><code>Sample_1</code>,&nbsp;<code>sample-1</code>,&nbsp;<code>S1</code>, और&nbsp;<code>control1</code>&mdash;<br />ये सब एक ही सैंपल हैं क्या?<br />पता तब चलता है जब पूछो दो-तीन बार।</p><p>काउंट मैट्रिक्स तैयार, अब R या Python की बारी,<br />QC करो, PCA प्लॉट&mdash;पर कुछ गड़बड़ भारी।<br />ट्यूमर और नॉर्मल का अदला-बदली खेल,<br />बार-बार, वही पुरानी झमेल।</p><p>आख़िर में आया मॉडलिंग का समय,<br />स्टैट्स, प्लॉट्स, डिफरेंशियल एक्सप्रेशन का श्रम।<br />लेकिन घड़ी में 5 बज चुके हैं जनाब,<br />और 8 बजे तक UMAP चाहिए, साफ़-सुथरा जबाब।</p><p>तो मैं कोड लिखता हूँ रात भर बैठ कर,<br />कलर पैलेट, जीन लेबल, लीजेंड बाहर रख कर।<br />फ़ॉन्ट, पैनल, एक्सिस सब सुधार,<br />एक्सपोर्ट करता हूँ... और लैपटॉप कहता है&mdash;"अब नहीं यार!"</p><p>इसीलिए बायोइन्फॉर्मेटिक्स में लगता है समय,<br />ये &ldquo;बस सीरत चलाओ&rdquo; या &ldquo;वोल्कैनो प्लॉट बनाओ&rdquo; नहीं है।<br />ये है सिस्टम एडमिन का काम, डेटा की सफ़ाई,<br />QC, डिबगिंग, और सांइस की सच्ची लड़ाई।</p><p><strong>तो कुछ सीखें इस व्यथा से आप भी आज:</strong><br />24 घंटे पहले चमत्कार मत माँगिए।<br />अच्छे फ़िगर साफ़ डेटा से बनते हैं।<br />बायोइन्फॉर्मेटिक्स जादू नहीं, विज्ञान है।<br />समय से बात कीजिए, प्रक्रिया का सम्मान कीजिए।</p><p><strong>और उन सभी बायोइन्फॉर्मेटिशियनों को सलाम,</strong><br />जो दूसरों की प्रेज़ेंटेशन के लिए रातों में जागते हैं&mdash;<br />तुम हो फ़िगर्स के भूत लेखक,<br />तुम हो बिना नाम के सह-लेखक।<br />तुम पहले लेखक बनने के हक़दार हो&mdash;<br />और एक लंबी नींद के भी।</p><p>Note: Written with the help of AI/LLM Tools !</p></div></div>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/8987/the-dna-of-a-successful-bioinformatician-decoded</guid>
	<pubDate>Wed, 12 Mar 2014 13:41:26 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/8987/the-dna-of-a-successful-bioinformatician-decoded</link>
	<title><![CDATA[The DNA of a Successful Bioinformatician decoded !!!]]></title>
	<description><![CDATA[<p>Many blogs exist about successful bioinformatician, but this blog so far now is my personal view on characteristics of successful bioinformatician or computational biologist. &nbsp;Hmm &hellip; of course these views are subjective to my own personal experiences and therefore I don't claim that the view listed here is complete. As a human, I don&rsquo;t take them too serious. The success must not be the only target of your work. The target is to work on your own virtues; some of those virtues are the topic of this blog.</p><p><img src="http://bioinformaticsonline.com/mod/photo/genome_decode.png" alt="image" width="509" height="458" style="border: 0px; border: 0px;"><br /> <br /> <strong>1. Update new things continuously<br /></strong>As per my personal experience, it&rsquo;s not always easy to work as a bioinformatician! &nbsp;There are couple of reasons to say that; First computational part of biology make our life&rsquo;s a little harder compared to other professional categories. The fact - for instance - that the technology cycle in the bioinformatics world is very short, the actual knowledge becomes outdated in a few months or years. Therefore, we need to learn continuously - new things get important. Second, to stay on top of things we really need the strong will to be good at our job. That's probably the most important characteristic to bioinformatician. They are usually an excellent knowledge worker with great technical abilities, and have the will to be that over decades!<br /> <br /> <strong>2. Avoid the sentence </strong><strong>"I did not know what to do!"</strong><br /> In our computational biology lab, we generally face lots of technical problems. But as you know, it's impossible to know everything to do the computational biology jobs ( Yup.. because you need diverse and multidisciplinary knowledge to understand biological problems and resolve their respective solutions), therefore it's absolutely necessary that a bioinformatician finds its way through a new topic. How I typically do that is I use google and I talk to other experts in our laboratory or online biostar community to find out what they think. "I did not know what to do!" should not be an argument for us.<strong><br /><br /> <strong>3. To make oneself useful</strong></strong><br /> Several time it does happen, you finished our task earlier than expected; in such cases if you have some time left then: Take a coffee and play chess; reversi, etc. In my case I take a rest. Afterwards I think about what I could do that helps the team to achieve its targets, 'cause some of my team mates probably didn't finish! (at least if I didn't met them at coffee bar !!)</p><p><strong>4. Care for all</strong><br /> During my rigorous research duration; I attended several workshop organized by my University departments. I had a discussion with other research fellow, professors; I generally ask &hellip; what it really takes to make a team successful or to be a successful research leader. They always said: "Well, you need some caring people!" I think there is a lot truth in that statement. If we do not care about quality, timelines, good team culture, respectful communication (!!), clean code, if all this doesn&rsquo;t matter to us, then I believe the probability is higher that we fail in research and analysis. <br /> <br /> <strong>5. Be good with people</strong><br /> Because bioinformatician and computational biologist jobs typically involves to work in a (most wanted J cross-departmental!) team, therefore it's important that we're (more or less) good in dealing with other individuals. Everyone have their own strengths and weaknesses, just like us. It's important to treat all the research team mates with respect, regardless of their technical competence or contributions. Of course, sometimes people deserve a clear statement (!!!), but try to do these things one-on-one. Make sure nobody loses his face. Attend the meetings at the coffee bar; be good at table top soccer and go out once in a while to have a beer with your team. You know what I'm talking about.</p><p>At the end of a week I look back and I ask myself what I have produced. This could be paperwork, community days or (best!!) programming code. Always remember there is always a solution to a problem. Most of the times there are at least three solutions. So, don&rsquo;t just blame, suggest a solution.<br /> <br /> That's it. I am looking forward to your thoughts and comments!</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/42327/blaxter-lab</guid>
  <pubDate>Thu, 19 Nov 2020 08:05:28 -0600</pubDate>
  <link></link>
  <title><![CDATA[Blaxter Lab]]></title>
  <description><![CDATA[
<p>Using these high quality genomes we explore</p>

<p>the evolutionary history of genes and species, building phylogenetic trees of life<br />the contrasting roles of horizontal gene transfer and introgression in shaping evolution<br />the biology of symbioses, especially symbioses between eukaryotes and bacteria, and between parasites and their hosts<br />the processes that drive the evolution of pattern in the structure of chromosomes<br />the diversity of meiofauna, particularly tardigrades, nematodes and other Ecdysozoa<br />the genomics of extremophilia</p>

<p>More at https://www.sanger.ac.uk/group/blaxter-group/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/35267/a-computational-postdoc-position-and-a-bioinformatician-position</guid>
  <pubDate>Thu, 18 Jan 2018 16:29:42 -0600</pubDate>
  <link></link>
  <title><![CDATA[A computational postdoc position and a bioinformatician position]]></title>
  <description><![CDATA[
<p>A computational postdoc position and a bioinformatician position are available in Alessandro Romanel's Lab recently established at the Centre for Integrative Biology (CIBIO) in Trento, Italy. The positions are in the context of an AIRC grant and are immediately available.<br /> <br />Successful candidates will be involved in the design and implementation of strategies to study the role of inherited polymorphisms in combination with timedependent variables and somatic events on cancer genesis, progression and resistance.<br />The ideal postdoc candidate will have a PhD in Computer Science, Bioinformatics, Computational Biology or equivalent, experience in the analysis of next generation sequencing and high-density array data from human cells, strong analytical and quantitative background and programming skills. Background in cancer genomics is recommended.<br />The ideal bioinformatician candidate will have a four or five years degree in Computer Science, Bioinformatics or equivalent, experience in the management of large datasets, implementation of processing pipelines and strong programming skills. Background in biology/genomics is a plus.<br />Highly motivated individuals are invited to send a detailed CV, a cover letter describing research interests and experience, and contact information for two references to Alessandro Romanel (alessandro.romanel@unitn.it).</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/fun/view/4194/what-a-bioinformatician-always-dream-for</guid>
	<pubDate>Tue, 03 Sep 2013 15:31:17 -0500</pubDate>
	<link>https://bioinformaticsonline.com/fun/view/4194/what-a-bioinformatician-always-dream-for</link>
	<title><![CDATA[What a bioinformatician always dream for ???]]></title>
	<description><![CDATA[<ol style="color: #000000; background-color: #ffffff;">
<li>Well established bioinformatics labs with SGI(silicon graphics interface)</li>
<li>License of all commercial softwares.</li>
<li>Complete, and&nbsp;fully assembled genome of the girl :P</li>
<li>A girl/boy with lesser E-values and higher compatibility score.</li>
<li>Horoscope Match should be significant (not less that 18).</li>
<li>Laptops with broadband connections.</li>
<li>Licence to almost all genomics and proteomics servers.</li>
<li>All eBooks of bioinformatics.</li>
<li>Ready passport and Study visa.</li>
</ol>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/10415/bioinformatician-stuck-in-wet-lab</guid>
	<pubDate>Tue, 06 May 2014 12:46:56 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/10415/bioinformatician-stuck-in-wet-lab</link>
	<title><![CDATA[Bioinformatician stuck in wet-lab]]></title>
	<description><![CDATA[<p>This guide is aimed at pet bioinformaticians, and is meant to guide them towards better career development.</p>
<p><strong>1. Make friends with local bioinformatics groups</strong><br> <strong>2. Talk to your computing group</strong><br> <strong>3. Obtain clear expectations</strong><br> <strong>4. Rewrite your job description</strong><br> <strong>5. Papers</strong><br> <strong>6. Attend bioinformatics meetings</strong><br> <strong>7. Try first, ask later</strong></p><p>Address of the bookmark: <a href="http://biomickwatson.wordpress.com/2013/04/23/a-guide-for-the-lonely-bioinformatician/" rel="nofollow">http://biomickwatson.wordpress.com/2013/04/23/a-guide-for-the-lonely-bioinformatician/</a></p>]]></description>
	<dc:creator>Rahul Agarwal</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</guid>
	<pubDate>Mon, 29 Oct 2018 04:23:24 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</link>
	<title><![CDATA[Biologist versus computational biologist !]]></title>
	<description><![CDATA[<p>This is how it work :)</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/38029" length="69305" type="image/png" />
</item>

</channel>
</rss>