About the person:

Essential criteria:

Hold or be about to obtain* a PhD in Computational biology, Bioinformatics, computing science or related subjects. (*must be obtained within 3 months of the closing date for the post) or MSc equivalent with at least 3 years' work experience in a relevant role.
Significant relevant research experience in genomics or work experience in a relevant technical/scientific role.
Significant experience in managing and analysing NGS data and other big data.
Experience in developing and maintaining analysis pipelines.
Experience working with Linux/UNIX environments.
Proficiency with python, bash, R and/or equivalent languages.
To be successful at shortlisting stage, please ensure you clearly evidence in your application how you meet the essential and, where applicable, desirable criteria listed in the Candidate Information document linked on our website.

More at https://hrwebapp.qub.ac.uk/tlive_webrecruitment/wrd/run/ETREC107GF.open

In this tutorial series article, I will explore features and packages of python which are widely used in the big data, NGS, and bioinformatics. I will also walk through a real biological example which shows NGS data processing with the help of python packages and programming.

Python has a couple of points to recommend it to biologists and scientists specifically:

• It's widely used in the scientific community
• It has a couple of very well designed libraries for doing complex scientific computing (although we won't encounter them in this book)
• It lend itself well to being integrated with other, existing tools
• It has features which make it easy to manipulate strings of characters (for example, strings of DNA bases and protein amino acid residues, which we as biologists are particularly fond of)

In general, following are some of the important features of python which makes it a perfect fit for rapid application development.

• Python is interpreted language so the program does not need to be compiled. Interpreter parses the program code and generates the output.
• Python is dynamically typed, so the variables types are defined automatically.
• Python is strongly typed. So the developers need to cast the type manually.
• Less code and more use makes it more acceptable.
• Python is portable, extendable and scalable.

There are two major Python versions, Python 2 and Python 3. Python 2 and 3 are quite different. This tutorial uses Python 3, because it more semantically correct and supports newer features.

I will post tutorial on daily basis on this page. Check the sub-pages on right side.

Bioinformatician are not anti-social; We are just genome friendly.

Bioinformatician would love to change the biological world, but they won't give us the genetic code :P

If at first you don't succeed; call it version 1.0

The glass is neither half-full nor half-empty: it's actually have several genomes.

I'm BioGeek.

Fedup with LIPS, try God script.

Idiot, Go ahead, make my data!

Thank god, my genome just compiled.

Error message: "Out of space on genome drive:"

Shut up mobile elements, or i'll flush you out.

Never underestimate the internet bandwidth, u gotta incomplete.

Applied fuzzy logic to understand God's logic?

Warning! Overflow, delete chromosome !

Be nice to the BioGeek, for all you know they might be the next curator!

Beware of computational biologist they screw genes and protein.

Warning! Your genome is full of garbage, delete it !

Bad or missing mouse genome. Spank the cat? (Y/N)

Genome make very fast, very accurate mistakes.

Let's BLAST it.

Some genome never has transposons. It just develops random features.

Go watch CINEMA and have BLAST.

A: He was getting too Sassy.

What did the bioinformatician say when he found out his team stopped using version control?

A: Y’all better Git!

Why did the computational biologist stay home from work?

A: He had a code!

Why was the bioinformatician's paper was rejected?

A: Journal thought it seemed scripted.

How can you tell that a Bioinformatics is working?

A: You can hear him Grunting!

Why bioinformatician always silence?

A: Because bioinformatician calmly whisper, “SSH”

Why was the bioinformatician always so sleepy?

A: He/She wasn’t given any Java.

Why did the program/software hanged?

A: Because genome float.

Why was the class upset that its parent died?

A: Because it wouldn’t be getting the inheritance!

Why did bioinformatician always works on the command line?

A: Because they don't want to scare you with huge amount of data!

Why did the bioinformatician attend the gay pride parade?

A: They supported polymorphism.

Why did bioinformatician prefer awk, PerlOneliner?

A: Because even computer can't handle to load the data.

Why don’t bioinformatician get along with others?

A: They’re too MEAN.

Why computational biologist are cool?

A: Because they are scripted!!

Why they talk $ unzip; strip; touch; finger; grep; mount; fsck; more; yes; fsck; fsck; umount; clean; sleep;

A: Ah, Ohhh, dude, these are *NIX commands

Did they really hack genome?

A: Yes, I guess so.

Address of the bookmark: https://www.onezoom.org/

awk '/pattern1/ {Actions}
/pattern2/ {Actions}' file

The working of Awk is as follows
Awk reads the input files one line at a time.
For each line, it matches with given pattern in the given order, if matches performs the corresponding action.
If no pattern matches, no action will be performed.
In the above syntax, either search pattern or action are optional, But not both.
If the search pattern is not given, then Awk performs the given actions for each line of the input.
If the action is not given, print all that lines that matches with the given patterns which is the default action.
Empty braces with out any action does nothing. It wont perform default printing operation.
Each statement in Actions should be delimited by semicolon.
Say you have data.tsv with the following contents:

$ cat data/test.tsv
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2 ACTTTATATATT
contig3 ACTTATATATATATA
contig4 ACTTATATATATATA
contig5 ACTTTATATATT
By default Awk prints every line from the file.

$ awk '{print;}' data/test.tsv
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2 ACTTTATATATT
contig3 ACTTATATATATATA
contig4 ACTTATATATATATA
contig5 ACTTTATATATT
We print the line which matches the pattern contig3

$ awk '/contig3/' data/test.tsv
contig3 ACTTATATATATATA
Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.

$ awk '{print $1","$2;}' data/test.tsv
contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2,ACTTTATATATT
contig3,ACTTATATATATATA
contig4,ACTTATATATATATA
contig5,ACTTTATATATT

$ awk '{print $1","$NF;}' data/test.tsv
contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2,ACTTTATATATT
contig3,ACTTATATATATATA
contig4,ACTTATATATATATA
contig5,ACTTTATATATT

Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:

BEGIN { Actions before reading the file}
{Actions for everyline in the file}
END { Actions after reading the file }

For example,
$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv
Header,Sequence
contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2,ACTTTATATATT
contig3,ACTTATATATATATA
contig4,ACTTATATATATATA
contig5,ACTTTATATATT
-------
We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths > 14:

$ awk '{print (length($2)>14) ? $0">14" : $0"<=14";}' data/test.tsv
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG>14
contig2 ACTTTATATATT<=14
contig3 ACTTATATATATATA>14
contig4 ACTTATATATATATA>14
contig5 ACTTTATATATT<=14
We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:

$ awk 'NR==3{$0=$1}1' data/test.tsv
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2 ACTTTATATATT
contig3
contig4 ACTTATATATATATA
contig5 ACTTTATATATT
You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),

$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv
contig1 contig1 contig1
contig2 contig2 contig2
contig3 contig3 contig3
contig4 contig4 contig4
contig5 contig5 contig5
Although, we can also skip executing later blocks for a given line by using next keyword:

$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv
contig1 contig1
contig2 contig2
contig3
contig4 contig4
contig5 contig5

$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv
contig1 contig1
contig2 contig2

contig4 contig4
contig5 contig5
You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:

$ awk 'BEGIN{while((getline k <"data/test.tsv")>0) print "BEGIN:"k}{print}' data/test.tsv
BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
BEGIN:contig2 ACTTTATATATT
BEGIN:contig3 ACTTATATATATATA
BEGIN:contig4 ACTTATATATATATA
BEGIN:contig5 ACTTTATATATT
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2 ACTTTATATATT
contig3 ACTTATATATATATA
contig4 ACTTATATATATATA
contig5 ACTTTATATATT
You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:

$ awk '{i[$1]=1}END{for (j in i) print j"<="i[j]}' data/test.tsv
contig1<=1
contig2<=1
contig3<=1
contig4<=1
contig5<=1

My client provide innovative biomarker discovery and development services to the pharmaceutical industry. They partner with the pharmaceutical industry to develop and implement biomarker strategies, providing a full range of biomarker services from pre-clinical biomarker discovery, assay development, right through to the delivery of clinical tests in their CLIA lab.

As a Senior Statistician you would support this effort and be responsible for the management of technical experimental study design and data handling processes required for the discovery, development and commercial delivery of multiplex clinical diagnostic assays; You will:

Develop analytical experimental designs for multiplex clinical diagnostic assays in accordance with regulatory requirements (e.g. CLIA, FDA)
Lead and coordinate the evaluation of analytical studies including characterization, verification, and validation studies
Lead specification setting and specification alterations
Ensure DOE methodology is routinely used in analytical studies.
Work with the Operations Department to ensure robust, reproducible and precise assay development
Provide expertise of general aspects for Statistical Process Control
Provide statistical expertise for R&D, Quality, and Manufacturing
You will work in a fast-paced, project orientated environment and the ability to plan and execute objectives under tight timelines is a must. This is a unique opportunity suited for a qualified statistician with an interest in working to deliver first class data analysis support and solutions in a clinical setting.

Requirements

MSc or PhD in statistics or a related discipline
In depth knowledge of DOE methods to analytically validate, monitor and trouble shoot multiplex clinical diagnostic assays, ideally in a commercial/industrial setting
Experienced in the analysis of statistical technology evaluation, independent data and dependent data analysis, medical diagnostic accuracy, statistical graphics and reproducible reporting.
Excellent interpersonal, communication (including written and spoken English)
Ability to independently manage multiple projects and to deliver results on time per project deadlines
Proficient programming and analysis skills in one or more statistical package (e.g. R, Stata, SAS)
The following skills, while not mandatory, are highly desirable:

Development and validation of predictive models
Experience of clinical epidemiology, survival analysis, biomarker research, Bayesian methods, quantifying predictive accuracy.
Knowledge of regulatory standards for CLIA and/or FDA IVD tests
Reward

An attractive remuneration package will reflect the importance of this role and will include 6.8 weeks annual leave (pro rata, including fixed closure days), company pension scheme, enhanced sick pay and maternity entitlements, healthcare plan and opportunities for learning and development, as well as access to a company restaurant and parking facilities