BOL: Related items

VCFtools: perform common tasks with VCF files such as file validation, file merging, intersecting, complements

Rahul Nayak — Tue, 07 Aug 2018 10:01:46 -0500

VCFtools contains a Perl API (Vcf.pm) and a number of Perl scripts that can be used to perform common tasks with VCF files such as file validation, file merging, intersecting, complements, etc. The Perl tools support all versions of the VCF specification (3.2, 3.3, 4.0, 4.1 and 4.2), nevertheless, the users are encouraged to use the latest versions VCFv4.1 or VCFv4.2. The VCFtools in general have been used mainly with diploid data, but the Perl tools aim to support polyploid data as well. Run any of the Perl scripts with the --help switch to obtain more help.

Many of the Perl scripts require that the VCF files are compressed by bgzip and indexed by tabix (both tools are part of the tabix package, available for download here). The VCF files can be compressed and indexed using the following commands

bgzip my_file.vcf
tabix -p vcf my_file.vcf.gz

http://vcftools.sourceforge.net/perl_module.html

Address of the bookmark: http://vcftools.sourceforge.net/perl_module.html

Suisse Life Science Group

Rahul Agarwal — Sun, 07 Jan 2018 14:42:23 -0600

THE WORLD’S MOST UNIQUE HEALTH & WELLNESS SERVICE:

AI and science working together to manage the root causes of your aging

Personalized plan built from your biomarkers and devices

Biologically-active treatments (cellular health). No drugs.

Source is Linkedln link :

https://www.linkedin.com/company/5143768/

Address of the bookmark: https://suisselifescience.com/

Free Books on Machine Learning and Artificial Intelligent !

BioStar — Thu, 16 Mar 2023 00:10:24 -0500

An Introduction to Statistical Learning
This book provides a broad and less technical treatment of key topics in statistical learning. Each chapter includes an R lab. This book is appropriate for anyone who wishes to use contemporary tools for data analysis.

https://hastie.su.domains/ISLR2/ISLRv2_website.pdf

Python Data Science Handbook
You’ll learn how to use the core libraries essential for working with data in Python: particularly IPython, NumPy, Pandas, Matplotlib, Scikit-Learn, and related packages. This resource is perfect for tackling day-to-day issues such as cleaning, manipulating, and transforming data — or building machine learning models.

https://jakevdp.github.io/PythonDataScienceHandbook/

Dive into Deep Learning
Interactive deep learning book with code, math, and discussions. Implemented with PyTorch, NumPy/MXNet, JAX, and TensorFlow. Adopted at 400 universities from 60 countries

https://d2l.ai/

Approaching (Almost) Any Machine Learning Problem
This book is for people who have some theoretical knowledge of machine learning and deep learning and want to dive into applied machine learning. The book is more oriented towards how and what should you use to solve machine learning and deep learning problems. The book is for you if you are looking for guidance on approaching machine learning problems.

https://github.com/abhishekkrthakur/approachingalmost/blob/master/AAAMLP.pdf

Pattern Searching in a Single Genome

Aasha — Mon, 07 Mar 2016 05:02:51 -0600

Pattern searching holds much importance for biologists , for the understanding of DNA ( and its functionality) can be more than a matter of satisfying curiosity , but also give answers to many issuess uchas medical conditions . However,there are a number of ways of searching with in a single chromosome.

Address of the bookmark: https://www.stats.ox.ac.uk/__data/assets/pdf_file/0018/5373/LintonFinalReport.pdf

How to install Perl modules manually, using CPAN command, and other quick ways

Jit — Fri, 12 Jul 2013 07:20:24 -0500

As a bioinformatics programmer, and crunchy data analyser you need to install several perl modules and dependencies. Installing Perl modules manually by resolving all the dependencies is tedious and annoying process. Some of the packages like GD is the real pain.

However, Installing Perl modules using CPAN is a better solution, as it resolves all the dependencies automatically. In this article, let us review how to install Perl modules on Linux ( which is prefereced amonst bioinformatician) using both manual and CPAN method.

When a Perl module is not installed, application will display the following error message. In this example, XML::Parser Perl module is missing.

Can't locate XML/parser.pm in @INC (@INC contains:
/usr/lib/perl5/5.10.0/i386-linux-thread-multi
/usr/lib/perl5/5.10.0
/usr/local/lib/perl5/site_perl/5.10.0/i386-linux-thread-multi
/usr/local/lib/perl5/site_perl/5.10.0
/usr/lib/perl5/vendor_perl/5.10.0/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.10.0 /usr/lib/perl5/vendor_perl
/usr/lib/perl5/site_perl/5.10.0 .)

Manual Method of Perl Module Installation

Install Perl Modules Manually

This manual method is very useful when your computer or server is not connected to the Internet.

Download Perl module:
Go to CPAN Search website and search for the module that you wish to download. In this example, let us search, download and install XML::Parser Perl module. I have downloaded the XML-Parser-2.36.tar.gz to /home/download

# cd /home/download
# gzip -d XML-Parser-2.36.tar.gz
# tar xvf XML-Parser-2.36.tar
# cd XML-Parser-2.36

Build the perl module:
Build by running Makefile.PL, remember the case sensitivity, make and make test.

# perl Makefile.PL
Checking if your kit is complete...
Looks good
Writing Makefile for XML::Parser::Expat
Writing Makefile for XML::Parser
# make
# make test

Install the perl module:
Now your package is ready to install.

# make install

As a newbie it looks pretty simple, and one go. But, luckily this is a very simple one module with no dependencies. Typically, Perl modules will be dependent on several other modules. Just imagine chasing all these dependencies one-by-one, thinking ... oh ye I got it. That will be very painful and annoying task. I recommend the CPAN method of installation as shown below.

Install Perl Modules using CPAN automatically

Logically, you should must have the CPAN perl module installed in your server or computer before you can install any other Perl modules using CPAN. I know you are laughing, "to install a perl module you need another perl module" ;)

Lets verify whether CPAN is already installed:

To install Perl modules using CPAN, make sure the cpan command is working. Following are the error message when CPAN module is not installed.

# cpan
-bash: cpan: command not found

# perl -MCPAN -e shell
Can't locate CPAN.pm in @INC (@INC contains:
/usr/lib/perl5/5.10.0/i386-linux-thread-multi
/usr/lib/perl5/5.10.0
/usr/local/lib/perl5/site_perl/5.10.0/i386-linux-thread-multi
/usr/local/lib/perl5/site_perl/5.10.0
/usr/lib/perl5/vendor_perl/5.10.0/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.10.0
/usr/lib/perl5/vendor_perl /usr/lib/perl5/site_perl/5.10.0 .).
BEGIN failed--compilation aborted.

Install the CPAN module using yum:
If CPAN in not installed in your system, you can use "yum" for the rescue. Dont worry biological data cruncher, this is true we are now dependent all these tiny magicians :).

# yum install perl-CPAN

Output of yum install perl-CPAN command:

Loaded plugins: refresh-packagekit
updates-newkey                       | 2.3 kB     00:00
primary.sqlite.bz2                   | 2.4 MB     00:00
Setting up Install Process
Parsing package install arguments

Resolving Dependencies
Transaction Summary
=============================================================================
Install      5 Package(s)
Update       0 Package(s)
Remove       0 Package(s)

Total download size: 1.0 M
Is this ok [y/N]: y
Downloading Packages:
(1/5): perl-ExtUtils-ParseXS-2.18-31.fc9.i386.rpm     | 30 kB     00:00
(2/5): perl-Test-Harness-2.64-31.fc9.i386.rpm         | 70 kB     00:00
(3/5): perl-CPAN-1.9205-31.fc9.i386.rpm               | 217 kB     00:00
(4/5): perl-ExtUtils-MakeMaker-6.36-31.fc9.i386.rpm   | 284 kB     00:00
(5/5): perl-devel-5.10.0-31.fc9.i386.rpm              | 408 kB     00:00

Installing     : perl-ExtUtils-ParseXS                             [1/5]
Installing     : perl-devel                                        [2/5]
Installing     : perl-Test-Harness                                 [3/5]
Installing     : perl-ExtUtils-MakeMaker                           [4/5]
Installing     : perl-CPAN                                         [5/5]

Installed: perl-CPAN.i386 0:1.9205-31.fc9
Dependency Installed:
perl-ExtUtils-MakeMaker.i386 0:6.36-31.fc9
perl-ExtUtils-ParseXS.i386 1:2.18-31.fc9
perl-Test-Harness.i386 0:2.64-31.fc9
perl-devel.i386 4:5.10.0-31.fc9
Complete!

Configure cpan the first time:
Once the CPAN is installed, you need to configure it by executing cpan, you should set some configuration parameters as shown below. I have shown only the important configuration parameters below. Accept all the default values by pressing enter.

Note: Make sure to execute “o conf commit” in the cpan prompt after the configuration to save the settings.

# cpan

Sorry, we have to rerun the configuration dialog for CPAN.pm due
to some missing parameters...

CPAN build and cache directory? [/root/.cpan]
Download target directory? [/root/.cpan/sources]
Directory where the build process takes place? [/root/.cpan/build]

Always commit changes to config variables to disk? [no]
Cache size for build directory (in MB)? [100]
Let the index expire after how many days? [1]

Perform cache scanning (atstart or never)? [atstart]
Cache metadata (yes/no)? [yes]
Policy on building prerequisites (follow, ask or ignore)? [ask]

Parameters for the 'perl Makefile.PL' command? []
Parameters for the 'perl Build.PL' command? []

Your ftp_proxy? []
Your http_proxy? []
Your no_proxy? []
Is it OK to try to connect to the Internet? [yes]

First, pick a nearby continent and country by typing in the number(s)
(1) Africa
(2) Asia
(3) Central America
(4) Europe
(5) North America
(6) Oceania
(7) South America
Select your continent (or several nearby continents) [] 5

(1) Bahamas
(2) Canada
(3) Mexico
(4) United States
Select your country (or several nearby countries) [] 4

(2) ftp://carroll.cac.psu.edu/pub/CPAN/
(3) ftp://cpan-du.viaverio.com/pub/CPAN/
(4) ftp://cpan-sj.viaverio.com/pub/CPAN/
(5) ftp://cpan.calvin.edu/pub/CPAN
(6) ftp://cpan.cs.utah.edu/pub/CPAN/
e.g. '1 4 5' or '7 1-4 8' [] 2-16

cpan[1]> o conf commit
commit: wrote '/usr/lib/perl5/5.10.0/CPAN/Config.pm'

cpan[2]> quit
No history written (no histfile specified).
Lockfile removed.

Install Perl Modules using CPAN

Hey smile please, now you are ready with CPAN and can download modules in one line command.

You can use one of the following method to install a Perl module using cpan:

# perl -MCPAN -e 'install Bundle::BioPerl'

(or)

# cpan
cpan shell -- CPAN exploration and modules installation (v1.9205)
ReadLine support available (maybe install Bundle::CPAN or Bundle::CPANxxl?)

cpan[1]> install "Bundle::BioPerl"

In the example above, CPAN will check for Bundle::BioPerl dependencies and automatically resolves and installs Bundle::BioPerl with all the dependent Perl modules.

Quick Ways

Oh, look at your face.. smily hmm :). This is what your are looking for, a quick and best way to install Perl modules, Bioperl. Following are the the steps to download BioPerl in your server/computer.

# sudo apt-cache search perl BioPerl

Output will be like as follows:

bioperl - Perl tools for computational molecular biology
bioperl-run - BioPerl wrappers: scripts
libbio-perl-perl - BioPerl core perl modules
libbio-perl-run-perl - BioPerl wrappers: modules
libbio-samtools-perl - Perl interface to SamTools library for DNA sequencing
libbiojava-java - Java API to biological data and applications (default version)
libbiojava3-java - Java API to biological data and applications (default version)
python-biopython-sql - Biopython support for the BioSQL database schema
libbtlib-perl - library for basic sequence manipulation

# sudo apt-get install bioperl

If it is installed then flash the following message:

Reading package lists... Done
Building dependency tree
Reading state information... Done
bioperl is already the newest version.
0 upgraded, 0 newly installed, 0 to remove and 10 not upgraded.

In it is found not installed in your server or system them install all with dependencies.

You can use the same approach to install all the modules, and packages if required.

Thanks for reading. Best of luck for your research.

Perl Maven tutorial by Gabor Szabo

Jitendra Narayan — Fri, 09 Aug 2013 05:43:10 -0500

I personally reccoment this tutorial for Perl users.

More detail http://perlmaven.com/

Cava Deployment Tools

Jitendra Narayan — Wed, 14 Aug 2013 15:00:48 -0500

Cava Packager allows packaging of applications written in Perl. Packaged applications can be distributed without the need for an installation of Perl on the target machine. Cava Packager is currently distributed under a free to use license.

Supported Perl Versions

Threaded Perl with a shared libperl 5.8, 5.10, 5.12, 5.14, 5.16

Supported Operating Systems

    MS Windows XP and later 32 and 64 bit.

    Linux 32 and 64 bit - minimum glibc 2.5, GTK+ 2.10, libstdc++6.

    Linux 32 bit RHEL 3 and 4.

    Mac OSX 10.4 and 10.5 - ppc and i386.

    Mac OSX 10.6, 10.7, 10.8 - i386 and x86_64 ( 64 bit for Perl 5.16 only ).

Address of the bookmark: http://www.cavapackager.com/

Clean the FASTA file

Jit — Thu, 03 Oct 2013 14:19:14 -0500

Mostly FASTA file contain NNN characters, which can be replace by random A T G C character with this perl script. It also print the FASTA sequence name, N's counts, nucleotide count and percentage details at command prompt/standard output.

Perl One liner basics !!

Abhimanyu Singh — Sun, 24 May 2015 09:28:33 -0500

Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:

$ perl -e 'print "Hello, World!\n"'
Hello, World!

It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.

I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?

$ perl -e 'print "$^O\n"'
linux

It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:

$ perl -E 'say "$^O"'
linux

Pretty handy! say is a nifty feature that you'll use again and again.

Frequent words problem solution by Perl

Jit — Tue, 09 Jun 2015 23:38:44 -0500

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myStr=substr $string, $aa,$kmer;
   #print "$myStr\n";
   my $km=kmerMatch ($string, $myStr, $kmer);
   if ($km > $max) { $max = $km;}
   #print "$km\t$myStr\n";
   $myHash{$myStr}=$km;

}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myWin=substr $string, $aa,$kmer;
   if ($myWin eq $myStr) {
       #print "$myWin eq $myStr\n";
       $count++;
   }
}
return $count;
}