This script has been modified by others to convert InDels as well, e.g. this by David Eccles

./vcf2fq.pl -f <input.fasta> <all-site.vcf> > <output.fastq>

https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl

https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl

usage: orange_pipeline_refine.py [-h] [-w W] [--nmotifs NMOTIFS] [--iter ITER] [-c C]
[-s S] [-d] [-ff] [-v V]
positive_seq negative_seq

positional arguments:
positive_seq the fasta file for the positive sequences
negative_seq the fasta file for the negative sequences

Address of the bookmark: https://github.com/yanshen43/MCAT

Can't locate XML/parser.pm in @INC (@INC contains:
/usr/lib/perl5/5.10.0/i386-linux-thread-multi
/usr/lib/perl5/5.10.0
/usr/local/lib/perl5/site_perl/5.10.0/i386-linux-thread-multi
/usr/local/lib/perl5/site_perl/5.10.0
/usr/lib/perl5/vendor_perl/5.10.0/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.10.0 /usr/lib/perl5/vendor_perl
/usr/lib/perl5/site_perl/5.10.0 .)

Manual Method of Perl Module Installation

• Install Perl Modules Manually

This manual method is very useful when your computer or server is not connected to the Internet.

Download Perl module:
Go to CPAN Search website and search for the module that you wish to download. In this example, let us search, download and install XML::Parser Perl module. I have downloaded the XML-Parser-2.36.tar.gz to /home/download

# cd /home/download
# gzip -d XML-Parser-2.36.tar.gz
# tar xvf XML-Parser-2.36.tar
# cd XML-Parser-2.36

Build the perl module:
Build by running Makefile.PL, remember the case sensitivity, make and make test.

# perl Makefile.PL
Checking if your kit is complete...
Looks good
Writing Makefile for XML::Parser::Expat
Writing Makefile for XML::Parser
# make
# make test

Install the perl module:
Now your package is ready to install.

# make install

As a newbie it looks pretty simple, and one go. But, luckily this is a very simple one module with no dependencies. Typically, Perl modules will be dependent on several other modules. Just imagine chasing all these dependencies one-by-one, thinking ... oh ye I got it. That will be very painful and annoying task. I recommend the CPAN method of installation as shown below.

Install Perl Modules using CPAN automatically

Logically, you should must have the CPAN perl module installed in your server or computer before you can install any other Perl modules using CPAN. I know you  are laughing, "to install a perl module you need another perl module"  ;)

Lets verify whether CPAN is already installed:

To install Perl modules using CPAN, make sure the cpan command is working. Following are the error message when CPAN module is not installed.

# cpan
-bash: cpan: command not found

# perl -MCPAN -e shell
Can't locate CPAN.pm in @INC (@INC contains:
/usr/lib/perl5/5.10.0/i386-linux-thread-multi
/usr/lib/perl5/5.10.0
/usr/local/lib/perl5/site_perl/5.10.0/i386-linux-thread-multi
/usr/local/lib/perl5/site_perl/5.10.0
/usr/lib/perl5/vendor_perl/5.10.0/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.10.0
/usr/lib/perl5/vendor_perl /usr/lib/perl5/site_perl/5.10.0 .).
BEGIN failed--compilation aborted.

Install the CPAN module using yum:
If CPAN in not installed in your system, you can use "yum" for the rescue. Dont worry biological data cruncher, this is true we are now dependent all these tiny magicians :).

# yum install perl-CPAN

Output of yum install perl-CPAN command:

Loaded plugins: refresh-packagekit
updates-newkey                       | 2.3 kB     00:00
primary.sqlite.bz2                   | 2.4 MB     00:00
Setting up Install Process
Parsing package install arguments

Resolving Dependencies
Transaction Summary
=============================================================================
Install      5 Package(s)
Update       0 Package(s)
Remove       0 Package(s)

Total download size: 1.0 M
Is this ok [y/N]: y
Downloading Packages:
(1/5): perl-ExtUtils-ParseXS-2.18-31.fc9.i386.rpm     |  30 kB     00:00
(2/5): perl-Test-Harness-2.64-31.fc9.i386.rpm         |  70 kB     00:00
(3/5): perl-CPAN-1.9205-31.fc9.i386.rpm               | 217 kB     00:00
(4/5): perl-ExtUtils-MakeMaker-6.36-31.fc9.i386.rpm   | 284 kB     00:00
(5/5): perl-devel-5.10.0-31.fc9.i386.rpm              | 408 kB     00:00

Installing     : perl-ExtUtils-ParseXS                             [1/5]
Installing     : perl-devel                                        [2/5]
Installing     : perl-Test-Harness                                 [3/5]
Installing     : perl-ExtUtils-MakeMaker                           [4/5]
Installing     : perl-CPAN                                         [5/5]


Installed: perl-CPAN.i386 0:1.9205-31.fc9
Dependency Installed:
  perl-ExtUtils-MakeMaker.i386 0:6.36-31.fc9
  perl-ExtUtils-ParseXS.i386 1:2.18-31.fc9
  perl-Test-Harness.i386 0:2.64-31.fc9
  perl-devel.i386 4:5.10.0-31.fc9
Complete!

Configure cpan the first time:
Once the CPAN is installed, you need to configure it by executing cpan, you should set some configuration parameters as shown below. I have shown only the important configuration parameters below. Accept all the default values by pressing enter.

Note: Make sure to execute “o conf commit” in the cpan prompt after the configuration to save the settings.

# cpan

Sorry, we have to rerun the configuration dialog for CPAN.pm due
to some missing parameters...

CPAN build and cache directory? [/root/.cpan]
Download target directory? [/root/.cpan/sources]
Directory where the build process takes place? [/root/.cpan/build]

Always commit changes to config variables to disk? [no]
Cache size for build directory (in MB)? [100]
Let the index expire after how many days? [1]

Perform cache scanning (atstart or never)? [atstart]
Cache metadata (yes/no)? [yes]
Policy on building prerequisites (follow, ask or ignore)? [ask]

Parameters for the 'perl Makefile.PL' command? []
Parameters for the 'perl Build.PL' command? []

Your ftp_proxy? []
Your http_proxy? []
Your no_proxy? []
Is it OK to try to connect to the Internet? [yes]

First, pick a nearby continent and country by typing in the number(s)
(1) Africa
(2) Asia
(3) Central America
(4) Europe
(5) North America
(6) Oceania
(7) South America
Select your continent (or several nearby continents) [] 5

(1) Bahamas
(2) Canada
(3) Mexico
(4) United States
Select your country (or several nearby countries) [] 4

(2) ftp://carroll.cac.psu.edu/pub/CPAN/
(3) ftp://cpan-du.viaverio.com/pub/CPAN/
(4) ftp://cpan-sj.viaverio.com/pub/CPAN/
(5) ftp://cpan.calvin.edu/pub/CPAN
(6) ftp://cpan.cs.utah.edu/pub/CPAN/
e.g. '1 4 5' or '7 1-4 8' [] 2-16

cpan[1]> o conf commit
commit: wrote '/usr/lib/perl5/5.10.0/CPAN/Config.pm'

cpan[2]> quit
No history written (no histfile specified).
Lockfile removed.

• Install Perl Modules using CPAN

Hey smile please, now you are ready with CPAN and can download modules in one line command.

You can use one of the following method to install a Perl module using cpan:

# perl -MCPAN -e 'install Bundle::BioPerl'

(or)

# cpan
cpan shell -- CPAN exploration and modules installation (v1.9205)
ReadLine support available (maybe install Bundle::CPAN or Bundle::CPANxxl?)

cpan[1]> install "Bundle::BioPerl"

In the example above, CPAN will check for Bundle::BioPerl dependencies and automatically resolves and installs Bundle::BioPerl with all the dependent Perl modules.

• Quick Ways

Oh, look at your face.. smily hmm :). This is what your are looking for, a quick and best way to install Perl modules, Bioperl. Following are the the steps to download BioPerl in your server/computer.

# sudo apt-cache search perl BioPerl

Output will be like as follows:

bioperl - Perl tools for computational molecular biology
bioperl-run - BioPerl wrappers: scripts
libbio-perl-perl - BioPerl core perl modules
libbio-perl-run-perl - BioPerl wrappers: modules
libbio-samtools-perl - Perl interface to SamTools library for DNA sequencing
libbiojava-java - Java API to biological data and applications (default version)
libbiojava3-java - Java API to biological data and applications (default version)
python-biopython-sql - Biopython support for the BioSQL database schema
libbtlib-perl - library for basic sequence manipulation

# sudo apt-get install bioperl

If it is installed then flash the following message:

Reading package lists... Done
Building dependency tree      
Reading state information... Done
bioperl is already the newest version.
0 upgraded, 0 newly installed, 0 to remove and 10 not upgraded.

In it is found not installed in your server or system them install all with dependencies.

You can use the same approach to install all the modules, and packages if required.

Thanks for reading. Best of luck for your research.

More detail http://perlmaven.com/

Supported Perl Versions

Threaded Perl with a shared libperl  5.8, 5.10, 5.12, 5.14, 5.16

Supported Operating Systems

    MS Windows XP and later 32 and 64 bit.

    Linux 32 and 64 bit - minimum glibc 2.5, GTK+ 2.10, libstdc++6.

    Linux 32 bit  RHEL 3 and 4.

    Mac OSX 10.4 and 10.5 - ppc and i386.

    Mac OSX 10.6, 10.7, 10.8  - i386 and x86_64 ( 64 bit for Perl 5.16 only ).

Address of the bookmark: http://www.cavapackager.com/

To run:

perl centro.pl

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

ICRISAT is headquartered in Patancheru near Hyderabad, India, with two regional hubs and five country offices in sub-Saharan Africa. ICRISAT, established in 1972, is a member of the CGIAR Consortium. For more details, see www.icrisat.org.

Responsibilities:Design efficient SQL queries for pulling large sequencing projects.
Serve as a technical adviser to the project leadership and provide computational perspective on product design and deliverability.
Develop and oversee a rapid and incremental software development and release schedule.
Design the software architecture, oversee the implementation and evolution of the design on appropriate hardware platforms.
Working collaboratively in a team environment to design, code, test, debug, and document programs for an integrated genomic analysis pipeline in a rapid and incremental software development and release schedule.
Supervise and review code development and ensure that software products meet project objectives in terms of functionality, scalability, robustness and user experience.
Implement and oversee the QA/QC practices to ensure the development team is adhering to quality standards.
Work closely with the application specialist to integrate feedbacks from teams in each CGIAR center into software customization and improvement.
Assist in training of breeders in the CGIAR centers to use software developed.
Personal Profile:

The applicant should have:

Understanding of genomics data and advanced knowledge of Java, and C/C++ as the programming languages and any of the scripting language like perl and/or Python, SQL
High Performance Computing, data architecture, database platforms and QA/QC practices in software engineering.
She/he should have solid experience in software development projects, preferably as a senior programmer or in the software project management role, and in projects involving big data.
Excellent communication skills are needed to work in this multi-disciplinary, multi-location and multi-cultural team.
Ability to mentor colleagues in quality software development practices is desired.
Educational Qualification : Ph. D or Masters Degree in Computational Biology / Computational Genomics or Equivalent with Research Experience in Mentioned Areas.

More at http://www.icrisat.org/careers/

Followings are the quick way to check if a value exist in an array.

do_something if 'flour' ~~ @ingredients   # ~~ operand.   BEWARE: it is broken.

do_something if grep {$_ eq 'flour'} @ingredients # grep (slower than 'any')

do_something if any {$_ eq 'flour'} @ingredients # List::MoreUtils / Util::Any

do_something if any(@ingredients) eq 'flour'   # use syntax 'junction';

do_something if @ingredients->contains('flour')   # added with autobox