<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/6052?offset=20</link>
	<atom:link href="https://bioinformaticsonline.com/related/6052?offset=20" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/4959/evolution-and-cancer</guid>
	<pubDate>Fri, 27 Sep 2013 11:28:49 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/4959/evolution-and-cancer</link>
	<title><![CDATA[Evolution and Cancer]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/j3uKOcNwYBw" frameborder="0" allowfullscreen></iframe>Air date:  Wednesday, January 04, 2012, 3:00:00 PM
Time displayed is Eastern Time, Washington DC Local  
 
Category:  Wednesday Afternoon Lectures  
Description:  There is a broad consensus that cancer is the result of somatic cells having serially gained, by a series of mutations, the ability to grow independently, to recruit resources from the circulation and the stroma, to invade local tissues, and to found anatomically distant metastases, ultimately killing the host. From the point of view of the cancer-causing somatic cell population, this is evolution driven by mutation and selection. Genomics has resulted in a parallel consensus that the central functions of all eukaryotes are highly conserved, not only at the level of individual protein functions, but also complex biological pathways and systems. These ideas motivated a comparison between results of molecular genetic studies of experimental evolution in yeast and the molecular genetic phenomena associated with tumorigenesis and tumor progression. We find some very striking similarities, including recurring genomic rearrangements, alterations of the regulation of specific growth-promoting genes, population-genetic features that affect the fitness trajectories of growth rate variants in evolving populations, and physiological and metabolic similarities derived from the conservation of the basic plan of growth and cell multiplication among all eukaryotes. It is hoped that some of the insights from yeast will aid the interpretation of sequence changes found in tumors, especially in the urgent necessity to distinguish 'driver' from 'passenger' mutations." 

David Botstein's fundamental contributions to modern genetics include the development of genetic methods for understanding biological functions and the discovery of the functions of many yeast and bacterial genes. In 1980, Botstein and three colleagues proposed a method for mapping human genes that laid the groundwork for the Human Genome Project. The basic principle of the mapping scheme was to develop, by recombinant DNA techniques, random single-copy DNA probes capable of detecting DNA sequence polymorphisms when hybridized to restriction digests, or specific fragments, of an individual's DNA. The method was used in subsequent years to identify several human disease genes, such as Huntington's and BRCA1. Variations of this method enabled the sequencing phase of the Human Genome Project. 

In the 1990s Botstein, having moved to Stanford University School of Medicine, collaborated with Patrick O. Brown of Stanford in exploiting DNA microarrays to study genome-wide gene expression patterns in yeast and in human cancers. This required developing a new statistical method and graphical interface, widely used today to interpret genomic data. Botstein also has helped to create, with Michael Ashburner and Gerald Rubin, a bioinformatics initiative to unify the representation of gene and gene product attributes across all species, called Gene Ontology. He graduated from Harvard College and earned his doctorate from the University of Michigan. He worked at Massachusetts Institute of Technology from 1967 to 1988; served as vice president for science at Genentech from 1988 to 1990; chaired the Department of Genetics at the Stanford University School of Medicine from 1990 to 2003; and joined the Princeton University faculty in 2003. He has sat on numerous editorial boards and was the founding editor of Molecular Biology of the Cell. Among recent major awards, Bostein won the Peter Gruber Foundation Prize in Genetics in 2003, the Apple Science Innovator Award in 2008, and the Albany Medical Center Prize in 2010. 

The NIH Wednesday Afternoon Lecture Series includes weekly scientific talks by some of the top researchers in the biomedical sciences worldwide. 

For more information, visit: The NIH Director's Wednesday Afternoon Lecture Series  
Author:  Dr. David Botstein, Princeton University  
Runtime:  00:59:58  

Permanent link:  http://videocast.nih.gov/launch.asp?17046]]></description>
	
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/14756/roderic-guigo-lab</guid>
  <pubDate>Mon, 01 Sep 2014 17:13:00 -0500</pubDate>
  <link></link>
  <title><![CDATA[Roderic Guigó Lab]]></title>
  <description><![CDATA[
<p>Research in our group focuses on the investigation of the signals involved in gene specification in genomic sequences (promoter elements, splice sites, translation initiation sites, etc…). We are interested both in the mechanism of their recognition and processing, and in their evolution. In addition, but related to this basic component of our research, our group is also involved in the development of software for gene prediction and annotation in genomic sequences. Our group also actively participates in the analysis of many eukaryotic genomes and it in involved in the NIH-funded ENCODE project. Furthermore we are members of two large cancer-studies consortia (chronic lymphocytic leukemia "CLL" and Breast Cancer -Hospital del Mar/CRG/Roche-).  <br /> <br />More at http://big.crg.cat/computational_biology_of_rna_processing</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/4211/socbin-bioinformatics-2014</guid>
  <pubDate>Tue, 03 Sep 2013 18:50:20 -0500</pubDate>
  <link></link>
  <title><![CDATA[SocBiN Bioinformatics 2014]]></title>
  <description><![CDATA[
<p>14th annual conference in Bioinformatics</p>

<p>Date : June 10-13</p>

<p>Organizers: The Society for Bioinformatics in Northern European countries (SocBiN) and the Norwegian Bioinformatics Platform / ELIXIR.NO </p>

<p>Venue: Department of Informatics, University of Oslo, Norway</p>

<p>Topics:<br />Tools and technologies for integrative bioinformatics<br />Metagenomics<br />Comparative genomics and phylogeny<br />Post-ENCODE bioinformatics<br />Gene regulation<br />Cancer genomes<br />Marine genomics</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/34912/list-of-cancer-genomics-research-web-resources</guid>
	<pubDate>Wed, 27 Dec 2017 20:33:09 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/34912/list-of-cancer-genomics-research-web-resources</link>
	<title><![CDATA[List of cancer genomics research web resources !]]></title>
	<description><![CDATA[<p>Major web resources for cancer genomics research</p><p>CGHub <br />https://cghub.ucsc.edu/ <br />Comprehensive data repository; huge data size</p><p>EGA <br />https://www.ebi.ac.uk/ega/ <br />Comprehensive data repository; huge data size</p><p>COSMIC <br />http://cancer.sanger.ac.uk <br />Largest somatic mutation database; genome sequencing paper curation</p><p>CPRG <br />http://www.broadinstitute.org/software/cprg <br />Interface for cancer program resources</p><p>GDAC <br />http://gdac.broadinstitute.org/ <br />Data analysis; automatic pipelines; user-friendly reports</p><p>SNP500Cancer <br />http://snp500cancer.nci.nih.gov <br />Sequence and genotype verification of SNPs</p><p>canEvolve <br />www.canevolve.org/ <br />Comprehensive analysis of tumor profile; Data from 90 studies involving more than 10,000 patients</p><p>MethyCancer <br />http://methycancer.psych.ac.cn <br />Relationship among DNA methylation, gene expression and cancer</p><p>SomamiR <br />http://compbio.uthsc.edu/SomamiR/ <br />Correlation between somatic mutation and microRNA; genome-wide displaying</p><p>cBioPortal <br />http://www.cbioportal.org/public-portal/ <br />Graphical summaries; gene alteration; processed data; visualization</p><p>UCSC Cancer Genomics Browser <br />https://genome-cancer.soe.ucsc.edu/ <br />Clinical information; gene expression; copy number variation; visualization</p><p>CGWB <br />https://cgwb.nci.nih.gov/ <br />Visualization; gene mutation and variation; automated analysis pipeline</p><p>GDSC <br />http://www.cancerrxgene.org <br />Drug sensitivity information; drug response information</p><p>canSAR <br />https://cansar.icr.ac.uk/ <br />Multidisciplinary information; drug discovery</p><p>NONCODE <br />http://www.noncode.org/ ncRNAs; <br />lncRNAs; up-to-date and comprehensive resource</p>]]></description>
	<dc:creator>biogeek</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/14302/bioinformatician-at-work</guid>
	<pubDate>Sat, 23 Aug 2014 04:44:55 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/14302/bioinformatician-at-work</link>
	<title><![CDATA[Bioinformatician at work !!!]]></title>
	<description><![CDATA[<p>Yet another peep up view of a bioinformatician research laboratory ...</p>]]></description>
	<dc:creator>Neel</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/14302" length="232751" type="image/png" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/45169/life-of-a-bioinformatician</guid>
	<pubDate>Fri, 15 May 2026 02:30:08 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/45169/life-of-a-bioinformatician</link>
	<title><![CDATA[Life of a Bioinformatician !]]></title>
	<description><![CDATA[<div><div><div><div><div><div><div dir="auto"><div><div><p>Somewhere between FASTQ files, volcano plots, and 3 AM coffee&hellip; the gene is probably hiding too.</p><p>#Bioinformatics #Genomics #ResearchL</p></div></div></div></div></div></div></div></div></div>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/45169" length="2686336" type="image/png" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36603/learning-python-programming-a-bioinformatician-perspective</guid>
	<pubDate>Mon, 14 May 2018 16:33:03 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36603/learning-python-programming-a-bioinformatician-perspective</link>
	<title><![CDATA[Learning Python Programming - a bioinformatician perspective !]]></title>
	<description><![CDATA[<p>Python Programming&nbsp;is a general purpose programming language that is open source, flexible, powerful and easy to use. One of the most important features of python is its rich set of utilities and libraries for data processing and analytics tasks. In the current era of big biological data, python and biopython is getting more popularity due to its easy-to-use features which supports big data processing.</p><p>In this tutorial series article, I will explore features and packages of python which are widely used in the big data, NGS, and bioinformatics. I will also walk through a real biological example which shows NGS data processing with the help of python packages and programming.</p><p>Python has a couple of points to recommend it to biologists and scientists specifically:</p><ul>
<li>It's widely used in the scientific community</li>
<li>It has a couple of very well designed libraries for doing complex scientific computing (although we won't encounter them in this book)</li>
<li>It lend itself well to being integrated with other, existing tools</li>
<li>It has features which make it easy to manipulate strings of characters (for example, strings of DNA bases and protein amino acid residues, which we as biologists are particularly fond of)</li>
</ul><p>In general, following are some of the important features of python which makes it a perfect fit for rapid application development.</p><ul>
<li>Python is interpreted language so the program does not need to be compiled. Interpreter parses the program code and generates the output.</li>
<li>Python is dynamically typed, so the variables types are defined automatically.</li>
<li>Python is strongly typed. So the developers need to cast the type manually.</li>
<li>Less code and more use makes it more acceptable.</li>
<li>Python is portable, extendable and scalable.</li>
</ul><p>There are two major Python versions, Python 2 and Python 3. Python 2 and 3 are quite different. This tutorial uses Python 3, because it more semantically correct and supports newer features.</p><p>I will post tutorial on daily basis on this page. Check the sub-pages on right side.</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/4655/mathivanan-lab</guid>
  <pubDate>Fri, 20 Sep 2013 13:09:38 -0500</pubDate>
  <link></link>
  <title><![CDATA[Mathivanan Lab]]></title>
  <description><![CDATA[
<p>The major research interests are in exploring the role of extracellular matrix components (soluble secreted proteins and membrane vesicles) in cancer and intercellular communication. The lab integrates proteomic, genomic and bioinformatics methodologies to explore cancer cells. </p>

<p>More at http://www.mathivananlab.org/index.html</p>

<p>http://scholar.google.com/citations?user=U6PyEdYAAAAJ&amp;hl=en</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/4409/huber-lab</guid>
  <pubDate>Mon, 09 Sep 2013 21:57:03 -0500</pubDate>
  <link></link>
  <title><![CDATA[Huber Lab]]></title>
  <description><![CDATA[
<p>The Huber group develops computational and statistical methods to design and analyse novel experimental approaches in genetics and cell biology. </p>

<p>Future projects and goals</p>

<p>Large-scale systematic maps of gene-gene and gene-environment interactions by automated phenotyping, using image analysis, machine learning, sparse model building and causal inference.<br />DNA-, RNA- and ChIP-Seq and their applications to gene expression regulation: statistical and computational foundations.<br />Cancer genomics, genomes as biomarkers, cancer phylogeny.<br />Image analysis for systems biology: measuring the dynamics of cell cycle and of cell migration of individual cells under normal conditions and many different perturbations (RNAi, drugs).</p>

<p>More @ http://www.embl.de/research/units/genome_biology/huber/index.html</p>
]]></description>
</item>

</channel>
</rss>