<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/6052?offset=20</link>
	<atom:link href="https://bioinformaticsonline.com/related/6052?offset=20" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/5623/yau-group</guid>
  <pubDate>Tue, 15 Oct 2013 13:05:15 -0500</pubDate>
  <link></link>
  <title><![CDATA[Yau Group]]></title>
  <description><![CDATA[
<p>Yau Group are a new research group based at the Wellcome Trust Centre for Human Genetics and the Department of Statistics at the University of Oxford.</p>

<p>Yau Group develops statistical and computational methods for the analysis of genomic datasets with a particular interest in cancer sequencing applications and the use of Bayesian Statistics.</p>

<p>Yau Group are currently have projects in somatic mutation analysis of heterogeneous cancers, data fusion or integration techniques and single cell genomics.</p>

<p>More @ http://www.well.ox.ac.uk/~cyau/index.html</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/6561/mathomics-lab</guid>
  <pubDate>Tue, 19 Nov 2013 18:17:32 -0600</pubDate>
  <link></link>
  <title><![CDATA[MATHomics Lab]]></title>
  <description><![CDATA[
<p>Mathomics is a collaborative research group of the Center for Mathematical Modeling and the Center for Genome Regulation at University of Chile, created to play a central role in the development of biotechnological projects, providing state of the art bioinformatics and mathematical modeling tools,  allowing to face these problems from the point of view of Systems Biology. </p>

<p>Lab page @ http://www.mathomics.cl/</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/43272/bioinformatics-head-bioinformatics-manager-iii-cancer-genomics-research-laboratory-at-frederick-national-laboratory</guid>
  <pubDate>Wed, 18 Aug 2021 00:19:48 -0500</pubDate>
  <link></link>
  <title><![CDATA[Bioinformatics Head (Bioinformatics Manager III), Cancer Genomics Research Laboratory at  Frederick National Laboratory]]></title>
  <description><![CDATA[
<p>Frederick National Laboratory seeking an enthusiastic, creative, and seasoned bioinformatics professional to join our leadership team and direct the exceptional Bioinformatics Group at the Cancer Genomics Research Laboratory (CGR).  CGR has a diverse team of bioinformatics and computational scientists that support all areas of bioinformatics and data analysis (infrastructure, data QC, pipeline development and maintenance, data curation and sharing, methodology development, statistical analyses, machine learning approaches, and scientific interpretation).</p>

<p>More at https://leidosbiomed.csod.com/ats/careersite/jobdetails.aspx?site=4&amp;c=leidosbiomed&amp;id=2040</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/12995/national-center-for-bioinformatics-ncb</guid>
  <pubDate>Wed, 23 Jul 2014 14:10:49 -0500</pubDate>
  <link></link>
  <title><![CDATA[National Center for Bioinformatics (NCB)]]></title>
  <description><![CDATA[
<p>NCB is offering M.Phil and Ph.D programs in the area of Bioinformatics. The major goal of NCB is to promote quality training and research in the area of Bioinformatics. Bioinformatics originated as a cross-disciplinary field as the need for computational sections to research problem raised in biomedicine. </p>

<p>More at http://ncb.qau.edu.pk/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/14302/bioinformatician-at-work</guid>
	<pubDate>Sat, 23 Aug 2014 04:44:55 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/14302/bioinformatician-at-work</link>
	<title><![CDATA[Bioinformatician at work !!!]]></title>
	<description><![CDATA[<p>Yet another peep up view of a bioinformatician research laboratory ...</p>]]></description>
	<dc:creator>Neel</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/14302" length="232751" type="image/png" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/23119/senior-statistician-manchester-or-belfast-uk</guid>
  <pubDate>Fri, 03 Jul 2015 08:06:04 -0500</pubDate>
  <link></link>
  <title><![CDATA[Senior Statistician - Manchester or Belfast UK]]></title>
  <description><![CDATA[
<p>The Role</p>

<p>My client provide innovative biomarker discovery and development services to the pharmaceutical industry.  They partner with the pharmaceutical industry to develop and implement biomarker strategies, providing a full range of biomarker services from pre-clinical biomarker discovery, assay development, right through to the delivery of clinical tests in their CLIA lab.</p>

<p>As a Senior Statistician you would support this effort and be responsible for the management of technical experimental study design and data handling processes required for the discovery, development and commercial delivery of multiplex clinical diagnostic assays; You will:</p>

<p>Develop analytical experimental designs for multiplex clinical diagnostic assays in accordance with regulatory requirements (e.g. CLIA, FDA)<br />Lead and coordinate the evaluation of analytical studies including characterization, verification, and validation studies<br />Lead specification setting and specification alterations<br />Ensure DOE methodology is routinely used in analytical studies.<br />Work with the Operations Department to ensure robust, reproducible and precise assay development<br />Provide expertise of general aspects for Statistical Process Control<br />Provide statistical expertise for R&amp;D, Quality, and Manufacturing<br />You will work in a fast-paced, project orientated environment and the ability to plan and execute objectives under tight timelines is a must. This is a unique opportunity suited for a qualified statistician with an interest in working to deliver first class data analysis support and solutions in a clinical setting.</p>

<p>Requirements</p>

<p>MSc or PhD in statistics or a related discipline<br />In depth knowledge of DOE methods to analytically validate, monitor and trouble shoot multiplex clinical diagnostic assays, ideally in a commercial/industrial setting<br />Experienced in the analysis of statistical technology evaluation, independent data and dependent data analysis, medical diagnostic accuracy, statistical graphics and reproducible reporting.<br />Excellent interpersonal, communication (including written and spoken English)<br />Ability to independently manage multiple projects and to deliver results on time per project deadlines<br />Proficient programming and analysis skills in one or more statistical package (e.g. R, Stata, SAS)<br />The following skills, while not mandatory, are highly desirable:</p>

<p>Development and validation of predictive models<br />Experience of clinical epidemiology, survival analysis, biomarker research, Bayesian methods, quantifying predictive accuracy.<br />Knowledge of regulatory standards for CLIA and/or FDA IVD tests<br />Reward</p>

<p>An attractive remuneration package will reflect the importance of this role and will include 6.8 weeks annual leave (pro rata, including fixed closure days), company pension scheme, enhanced sick pay and maternity entitlements, healthcare plan and opportunities for learning and development, as well as access to a company restaurant and parking facilities</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/fun/view/42877/bioinformatician-on-valentines-day</guid>
	<pubDate>Sun, 14 Feb 2021 11:36:32 -0600</pubDate>
	<link>https://bioinformaticsonline.com/fun/view/42877/bioinformatician-on-valentines-day</link>
	<title><![CDATA[Bioinformatician on Valentine's Day]]></title>
	<description><![CDATA[<p>Once asked to a bioinformatician "How is ur Valentine's Day?"</p><blockquote><p>Bioinformatician replied:</p><p>if ($date == "Valentine's Day" &amp;&amp; $me =! Bioinformatician) {</p><p>rose_day(); promise_day(); kiss_day();</p><p>}</p><p>else {</p><p>hack_genome(); ko-fi(); youtube(); do_scripting(); sleep();</p><p>)</p></blockquote>]]></description>
	<dc:creator>BioQueen</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/4873/vveks-lab</guid>
  <pubDate>Thu, 26 Sep 2013 11:11:39 -0500</pubDate>
  <link></link>
  <title><![CDATA[Vvek's Lab]]></title>
  <description><![CDATA[
<p>Broad Area of Research: RNA biology (microRNA, lncRNA), Stem cells, Functional genomics, Epigenomics and Cancer</p>

<p>RNAs, especially non-coding RNAs (such as microRNA, long ncRNAs) are recently identified to be very abundant in mammalian organisms and play some key roles in gene expression regulation, gene silencing, and also implicated in disease progression, stem cell pluripotency etc. Current research activities of our lab include analysis of expression pattern of ncRNAs by microarray and next-gen sequencing data and understanding the role of miRNAs or other regulatory RNAs in various diseases, especially cancer and validation by reporter assays (renilla/luciferase) and other experimental tools.</p>

<p>More @ http://vvekslab.in/index.html</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/7989/cancers-cure-is-on-the-way</guid>
	<pubDate>Wed, 22 Jan 2014 12:00:46 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/7989/cancers-cure-is-on-the-way</link>
	<title><![CDATA[Cancers cure is on the way !!!]]></title>
	<description><![CDATA[<p>The study on blind mole rat (Spalax) was carried out by researchers from the University of Haifa, Israel, and published in the peer-reviewed scientific journal BMC Biology.</p><p>The blind mole rat (Spalax) is an intriguing creature worthy of study. This was animal research examining the resistance subterranean blind mole rats (Spalax) have to cancers. Blind mole rats are one of a unique group of animals that spend their lives underground, are tolerant of very low oxygen levels (down to only 3% concentration &ndash; levels that would kill a human), have a long lifespan of more than 20 years, which is exceptional for a small rodent, and show no clear signs of ageing or age-related diseases.</p><p>This research has demonstrated the unique abilities of the blind mole rat to resist cancer, even when directly given potent cancer-causing chemicals. In this study researchers gave blind mole rats potent cancer-causing chemicals either through injections or applied directly to the skin, but the animals didn't develop cancer.<br /><br />Remarkably, connective tissue cells (fibroblasts) taken from the blind mole rat even prevented the growth of human cancer cells when they were grown together in the laboratory.<br /><br />In the laboratory, the researchers also demonstrated how connective tissue cells called fibroblasts taken from the animal seem to play an important role in this cancer resistance. These cells prevented the growth of human cancer cells when the two types of cells were grown together in the laboratory.<br /><br />The researchers concluded that, "This report provides pioneering evidence that Spalax [the blind mole rat] is not only resistant to spontaneous cancer, but also to experimentally induced cancer, and shows the unique ability of Spalax fibroblasts to inhibit growth and kill cancer cells, but not normal cells, either through direct fibroblast-cancer cell interaction or via soluble factors."</p><p>Nonetheless, there remains optimism that understanding the anti-cancer mechanisms of mole rats may one day help inform further cancer treatments for humans, but a lot more research &ndash; and probably a significant amount of time &ndash; is needed before this can be considered.</p><p><img src="http://i.telegraph.co.uk/multimedia/archive/02599/naked-mole-rat_2599114b.jpg" alt="image" width="620" height="387" style="border: 0px; border: 0px;"></p><p>Reference:</p><p>Image: telegraph.co.uk</p><p>http://www.biomedcentral.com/1741-7007/11/91</p><p>Manov, Irena, et al. "Pronounced cancer resistance in a subterranean rodent, the blind mole-rat, Spalax: in vivo and in vitro evidence." BMC biology 11.1 (2013): 91.</p><p>http://www.nhs.uk/news/2014/01January/Pages/Claims-of-a-universal-cure-for-cancer-misleading.aspx</p><p>http://www.express.co.uk/news/health/454188/EXCLUSIVE-Cure-for-ALL-cancers-is-on-the-way-as-scientists-discover-major-breakthrough</p><p>http://www.dailymail.co.uk/health/article-2540321/Could-mole-rats-hold-key-cure-cancer-Scientists-hail-potentially-life-changing-breakthrough.html</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>