BOL: Related items

getopts.pl file

Jit — Fri, 15 Jun 2018 04:43:03 -0500

SSPACE_longread complain for getopts.pl file.

To resolve this, download and have in SSPACED-Longreads folder.

Cheers :)

Five unique traits of effective computational biologist

Jitendra Narayan — Thu, 11 Jul 2013 13:12:51 -0500

Bioinformatics research is driven by large set of software, scripts, and tools to analyse gigantic biological data. Being a great biological programmer or bioinformatician involves more than writing code that works. The biological programmers who rise to the top ranks of their profession are not only good programmer but also expert in biological stuff. Moreover, In order to be a good and effective biological programmer, you need to possess a combination of traits that allow your computational as well as biological skill, experience, and knowledge to produce working code. There are some technically skilled biological programmers who will never be effective because they lack the other important traits needed. Here are top five traits that are necessary to become a great biological programmer.

1. Learn and get updated

Some of the bad biological programmers only learn new technical or non-technical things when it’s absolutely necessary. The good biological programmers learn new technical skills proactively. But great biological programmers not only learn new technical skills on their own but also learn non-technical skills, and have an open mind to sources of knowledge that others may shut out.

In other concrete term, the bad biological programmer learn Perl's regular expression when they started a project on comparative genomics; the good biological programmer learned it a year before because it looked interesting; and the great biological programmer also read about the BioPerl packages, genomics, DNA string, genomic theories, or some similar course of study so that they could understand the results and explain it biologically.

2. Not a merely coder!!!

I often encountered with biological programmer who call themself a hard-core computer programmer and avoid biology. I can almost guarantee that if you are one of them then you are not doing research but merely writing "dry" codes.

According to my supervisor most of the computational biologist, don't know what they are doing biologically. Even they struggle to explain their own programs output and results. Therefore, It is highly advisable to learn basic of biology which can assist you to explain the result and understand your discovery. Always remember you are a researcher not a coder.

3. Be Social with biologist

The computational biologist spends most of the time in from of computers, writing codes. They always think their job is to produce working codes, not technical research perfections. But, they are completely wrong. You should not forget that apart from your computational skills you also need some biologist, other than your supervisor, to explain and make you understand the complex biological mechanism.

I highly recommend your to interact with biotech researchers and learn how do they explain their one graph (which they generally produce after one year of work) biologically. Remember, the origin of your research project is complex biological phenomenon, which is more complex than that of your limited programming rules.

4. Do not search, research for answers

Researching for answers means more than typing several keywords into a search engine or posting a question at Stack Overflow or the BioStars forums. I have entered problems into search engines that generate no results, and every question I posted on Stack Overflow or the BioStars forums never got anything resembling an answer, yet I solved the issues and moved on. I’m not a magician — I just know how to find answers or discover root causes.

Many problems are situational, and if you depend on search engines and forums, you can waste a lot of time going down a rabbit hole and possibly never getting a solution. Learn to perform root cause analysis, learn enough about the underlying system to look for other clues and solutions, and learn to take a long distance view of an issue before deep diving into it.

5. Love and defend your research

You cannot rise to the top in this research profession without loving your work. There are some very good “it’s just a job” biological programmers (I’ve been one at times), but if that is your outlook, you won’t be willing to do whatever it takes to succeed. This idea gets a lot of folks in a huff, because they feel it is a personal insult. “I’m a good programmer, but I have other priorities and can’t make work my life.” I understand completely; I have other priorities too. As much as I hate to say it, when I am passionate about my work, I am willing (though not eager) to abandon my other priorities to finish the job. It is not an insult to say that if you aren’t willing to pull out all the stops you can’t be the best, it is a fact.

You must be passionate about more than programming — you must also be excited about your research, the tools and technology you are using, and so on. I have seen very good and even great biological programmers operating at mediocre levels because something was not a good fit, such as they hated the project or were using a technology they disliked. Therefore, like your research project and get excited about your discoveries. You have not only to discover but also defend your finding with scientific words.

Thanks to all of you for reading.

Perl Poem: Parse it in both Perl and English!

Rahul Agarwal — Mon, 12 Aug 2013 19:00:55 -0500

Larry's, er, corpus has fortunately been overshadowed by that of the reigning Perl Poet, Sharon Hopkins. She has written quite a few Perl poems, as well as a paper on Perl poetry that she presented at the Usenix Winter 1992 Technical Conference, entitled "Camels and Needles: Computer Poetry Meets the Perl Programming Language". (The paper is available as misc/poetry.ps on CPAN.) Besides being the most prolific Perl poet, Sharon is also the most widely published, having had the following poem published in both the Economist and the Guardian:

#!/usr/bin/perl

APPEAL:

listen (please, please);

open yourself, wide;
join (you, me),
connect (us,together),

tell me.

do something if distressed;

@dawn, dance;
@evening, sing;
read (books,$poems,stories) until peaceful;
study if able;

write me if-you-please;

sort your feelings, reset goals, seek (friends, family, anyone);

do*not*die (like this)
if sin abounds;

keys (hidden), open (locks, doors), tell secrets;
do not, I-beg-you, close them, yet.

accept (yourself, changes),
bind (grief, despair);

require truth, goodness if-you-will, each moment;

select (always), length(of-days)

# listen (a perl poem)
# Sharon Hopkins
# rev. June 19, 1995

Detect the sequence pattern and its location in fasta file with match and mismatches information.

Jit — Thu, 26 Sep 2013 15:02:53 -0500

This script is one of my old script to detect some centromeric pattern in chromosomes. User can also control the number of mismatches allowed through command line ..

To run:

perl centro.pl

Perl One liner basics !!

Abhimanyu Singh — Sun, 24 May 2015 09:28:33 -0500

Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:

$ perl -e 'print "Hello, World!\n"'
Hello, World!

It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.

I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?

$ perl -e 'print "$^O\n"'
linux

It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:

$ perl -E 'say "$^O"'
linux

Pretty handy! say is a nifty feature that you'll use again and again.

Frequent words problem solution by Perl

Jit — Tue, 09 Jun 2015 23:38:44 -0500

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myStr=substr $string, $aa,$kmer;
   #print "$myStr\n";
   my $km=kmerMatch ($string, $myStr, $kmer);
   if ($km > $max) { $max = $km;}
   #print "$km\t$myStr\n";
   $myHash{$myStr}=$km;

}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myWin=substr $string, $aa,$kmer;
   if ($myWin eq $myStr) {
       #print "$myWin eq $myStr\n";
       $count++;
   }
}
return $count;
}

Scientist - Computational Genomics (Two Positions)

Sat, 12 Mar 2016 18:07:56 -0600

ICRISAT is a non-profit, non-political organization that conducts agricultural research for development in Asia and sub-Saharan Africa with a wide array of partners throughout the world. Covering 6.5 million square kilometers of land in 55 countries, the semi-arid tropics is home to over 2 billion people, with 650 million of these being the poorest of the poor. ICRISAT and its partners help empower those living in the semi-arid tropics, especially smallholder farmers, to overcome poverty, hunger, malnutrition and a degraded environment through more efficient and profitable agriculture.

ICRISAT is headquartered in Patancheru near Hyderabad, India, with two regional hubs and five country offices in sub-Saharan Africa. ICRISAT, established in 1972, is a member of the CGIAR Consortium. For more details, see www.icrisat.org.

Responsibilities:Design efficient SQL queries for pulling large sequencing projects.
Serve as a technical adviser to the project leadership and provide computational perspective on product design and deliverability.
Develop and oversee a rapid and incremental software development and release schedule.
Design the software architecture, oversee the implementation and evolution of the design on appropriate hardware platforms.
Working collaboratively in a team environment to design, code, test, debug, and document programs for an integrated genomic analysis pipeline in a rapid and incremental software development and release schedule.
Supervise and review code development and ensure that software products meet project objectives in terms of functionality, scalability, robustness and user experience.
Implement and oversee the QA/QC practices to ensure the development team is adhering to quality standards.
Work closely with the application specialist to integrate feedbacks from teams in each CGIAR center into software customization and improvement.
Assist in training of breeders in the CGIAR centers to use software developed.
Personal Profile:

The applicant should have:

Understanding of genomics data and advanced knowledge of Java, and C/C++ as the programming languages and any of the scripting language like perl and/or Python, SQL
High Performance Computing, data architecture, database platforms and QA/QC practices in software engineering.
She/he should have solid experience in software development projects, preferably as a senior programmer or in the software project management role, and in projects involving big data.
Excellent communication skills are needed to work in this multi-disciplinary, multi-location and multi-cultural team.
Ability to mentor colleagues in quality software development practices is desired.
Educational Qualification : Ph. D or Masters Degree in Computational Biology / Computational Genomics or Equivalent with Research Experience in Mentioned Areas.

More at http://www.icrisat.org/careers/

Perl way to check if an array contains values

Shruti Paniwala — Thu, 09 Mar 2017 17:17:01 -0600

Perl is always is known for their flexibility (There is more than one way to do it).

Followings are the quick way to check if a value exist in an array.

do_something if 'flour' ~~ @ingredients # ~~ operand. BEWARE: it is broken.

do_something if grep {$_ eq 'flour'} @ingredients # grep (slower than 'any')

do_something if any {$_ eq 'flour'} @ingredients # List::MoreUtils / Util::Any

do_something if any(@ingredients) eq 'flour' # use syntax 'junction';

do_something if @ingredients->contains('flour') # added with autobox

Circleator

Jit — Sun, 25 Jun 2017 18:04:32 -0500

The Charm City Circleator--or Circleator for short--is a Perl-based visualization tool developed at the Institute for Genome Sciences in the University of Maryland's School of Medicine. Circleator produces circular plots of genome-associated data, like this one:

Common uses of the tool include:

Displaying the sequence and/or genes in a GenBank flat file.
Highlighting differences and/or similarities in gene content between related organisms.
Comparing SNPs and indels between closely-related strains or serovars.
Comparing gene expression values across multiple samples or timepoints.
Visualizing coverage plots of RNA-Seq read alignments.

Key Features

Circleator...

Builds on BioPerl and the input file formats that it supports, including:
- GenBank flat files, GFF, FASTA
Accepts a number of other commonly-used datatypes and file formats:
- BSR and TRF output, SAM/BAM files, VCF-encoded SNPs, tab-delimited files
Outputs publication-ready figures in the SVG (Scalable Vector Graphics) format.
Requires only a single configuration file whose layout mirrors that of the figure itself.
- Predefined configuration files and "track" types are supplied for common datasets.
- Advanced features allow limited analyses to be performed as a figure is drawn.
Includes an extensive set of regression tests.
Offers a prototype web-based GUI (under the "Ringmaster" project.)

https://github.com/jonathancrabtree/Circleator

Address of the bookmark: https://github.com/jonathancrabtree/Circleator

Frontend: Perl Web framework documentation - Andrej Sali Lab

Jit — Mon, 08 Jan 2018 22:32:03 -0600

The frontend is a set of Perl classes that displays the web interface, allowing a user to upload their input files, start a job, display a list of all jobs in the system, and get back job results. The main saliwebfrontend class must be subclassed for each web service. This class is then used to display the web pages using a set of CGI scripts that are set up automatically by the build system.

Address of the bookmark: https://saliweb.readthedocs.io/en/latest/frontend.html