Tenure: Initially upto six months and extendable based on performance.
The upper age limit can be relaxed up to 5 years in the case of applicant belonging to SC/ST/Woman/Physically handicapped and 3 years for OBCs.
No TA/DA will be paid for attending the interview.
More at http://www.biotechpark.org.in/index1.htm

Fungi are of central importance for the global carbon cycle because of
their role in the degredation of complex organic matter such as plant
material. Fungi also represent one of the last frontiers of
biodiversity, as their taxonomic diversity and metabolic potential
remain poorly understood. This is particularly true for those fungi that
are abundant in freshwaters.

\"MycoLink\" (Linking aquatic mycodiversity to ecosystem function) is an interdisciplinary project integrating the expertise of 4 Leibniz Institutes: IGB, ZALF, DSMZ, the Leibniz-Institute of Freshwater Ecology and Inland Fisheries (IGB), the Leibniz Centre for Agricultural Landscape Research (ZALF), and the Leibniz-Institute of Zoo- and Wildlife Research in Berlin (IZW). We are seeking to recruit outstanding young scientists to establish an innovative research program, and currently invite applications for:

PostDoc will focus on global biodiversity and evolutionary genomics of freshwater fungi, using second- and third-generation sequencing and bioinformatics to analyse natural populations and experimental cultures. For further information, contact Michael T. Monaghan (monaghan@igb-berlin.de) (http://monaghanlab.org).

PostDoc will focus on the ecological and functional role of aquatic fungi by combining state-of-the-art biochemical analyses with modeling in experimental and natural ecosystems. For further information, contact Hans-Peter Grossart & Katrin Premke (hgrossart@igb-berlin.de; premke@igb-berlin.de)

Applicants must hold a PhD in a relevant field. Positions are available for up to three years. Salary is according to the German TvD. Positions will be based at IGB Berlin, IGB Neuglobsow, and at the Berlin Centre for Genomics in Biodiversity Research. The institutes of the Leibniz Association strive to increase the proportion of female scientists. Therefore, female candidates are specifically encouraged to apply. Disabled applicants with identical technical and personal qualification will be preferentially selected.

Please submit a curriculum vitae (including publication list), a brief statement of motivation and research interests, and the names and contact information of two referees. Please send all documents as a single pdf file to monaghan@igb-berlin.de.

Review of the applications will start on 21 February 2014 and continue until the positions are filled. Interviews for shortlisted applicants will take place in March.

Biodiversity, Ecology, and Genomics of Aquatic Fungi
Leibniz-Institute of Freshwater Ecology and Inland Fisheries (IGB), Berlin, Germany

Deadline for applications : unknown.

Each node will host student interns interested in pursuing a research career in mathematical or computational biology at institutions located in its region.

Eligibility: Bachelors (3rd or 4th year) and Masters students

Average duration: 3 months (could be more in certain cases). These internships can be availed at any time during 2014 subject to consent from the faculty mentor.

Fellowship amount: Rs. 10,000 per month. In addition, outstation interns can receive up to Rs. 5000 per month for accommodation and Rs. 3000 for travel from and to their home place.

Application procedure: Apply online at http://nnmcb.appzone.co.in/

Deadline: February 10, 2014

Contact Information:

National Network for Mathematical and Computational Biology

Department of Mathematics

Indian Institute of Science

Bangalore 560 012

Tel: 080-2293 2893

Email: nnmcb@math.iisc.ernet.in

• the Damerau–Levenshtein distance allows insertion, deletion, substitution, and the transposition of two adjacent characters;
• the longest common subsequence (LCS) distance allows only insertion and deletion, not substitution;
• the Hamming distance allows only substitution, hence, it only applies to strings of the same length.
• the Jaro distance allows only transposition.

use Text::Levenshtein qw(distance);

 print distance("foo","four");
 # prints "2"

 my @words     = qw/ four foo bar /;
 my @distances = distance("foo",@words);

 print "@distances";
 # prints "2 0 3"

use Algorithm::LCSS qw( LCSS CSS CSS_Sorted );
    my $lcss_ary_ref = LCSS( \@SEQ1, \@SEQ2 );  # ref to array
    my $lcss_string  = LCSS( $STR1, $STR2 );    # string
    my $css_ary_ref = CSS( \@SEQ1, \@SEQ2 );    # ref to array of arrays
    my $css_str_ref = CSS( $STR1, $STR2 );      # ref to array of strings
    my $css_ary_ref = CSS_Sorted( \@SEQ1, \@SEQ2 );  # ref to array of arrays
    my $css_str_ref = CSS_Sorted( $STR1, $STR2 );    # ref to array of strings

There are many different modules on CPAN for calculating the edit distance between two strings. Here's just a selection.

Text::LevenshteinXS and Text::Levenshtein::XS are both versions of the Levenshtein algorithm that require a C compiler, but will be a lot faster than this module.

The Damerau-Levenshtein edit distance is like the Levenshtein distance, but in addition to insertion, deletion and substitution, it also considers the transposition of two adjacent characters to be a single edit. The module Text::Levenshtein::Damerau defaults to using a pure perl implementation, but if you've installed Text::Levenshtein::Damerau::XS then it will be a lot quicker.

Text::WagnerFischer is an implementation of the Wagner-Fischer edit distance, which is similar to the Levenshtein, but applies different weights to each edit type.

Text::Brew is an implementation of the Brew edit distance, which is another algorithm based on edit weights.

Text::Fuzzy provides a number of operations for partial or fuzzy matching of text based on edit distance. Text::Fuzzy::PP is a pure perl implementation of the same interface.

String::Similarity takes two strings and returns a value between 0 (meaning entirely different) and 1 (meaning identical). Apparently based on edit distance.

Text::Dice calculates Dice's coefficient for two strings. This formula was originally developed to measure the similarity of two different populations in ecological research.

Qualifications

PhD or Post-Graduated Master degree is required. Successful candidates will have some expertise in data analysis of NGS data by using methods running in R and UNIX environment. Familiarity with genome databases and browsers is required.

Application

Candidates should send a CV and a brief personal statement focusing on their skills and interests related to the research project.

Contacts

Start date: 1° April 2014
Salary on grant: 25,000 euros per year.
Contact Person (Referent): Mario Capasso
Ref. Email: mario.capasso@unina.it and achille.iolascon@unina.it
Tel: +39 081 3737889

awk '/pattern1/ {Actions}
/pattern2/ {Actions}' file

The working of Awk is as follows
Awk reads the input files one line at a time.
For each line, it matches with given pattern in the given order, if matches performs the corresponding action.
If no pattern matches, no action will be performed.
In the above syntax, either search pattern or action are optional, But not both.
If the search pattern is not given, then Awk performs the given actions for each line of the input.
If the action is not given, print all that lines that matches with the given patterns which is the default action.
Empty braces with out any action does nothing. It wont perform default printing operation.
Each statement in Actions should be delimited by semicolon.
Say you have data.tsv with the following contents:

$ cat data/test.tsv
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2 ACTTTATATATT
contig3 ACTTATATATATATA
contig4 ACTTATATATATATA
contig5 ACTTTATATATT
By default Awk prints every line from the file.

$ awk '{print;}' data/test.tsv
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2 ACTTTATATATT
contig3 ACTTATATATATATA
contig4 ACTTATATATATATA
contig5 ACTTTATATATT
We print the line which matches the pattern contig3

$ awk '/contig3/' data/test.tsv
contig3 ACTTATATATATATA
Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.

$ awk '{print $1","$2;}' data/test.tsv
contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2,ACTTTATATATT
contig3,ACTTATATATATATA
contig4,ACTTATATATATATA
contig5,ACTTTATATATT

$ awk '{print $1","$NF;}' data/test.tsv
contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2,ACTTTATATATT
contig3,ACTTATATATATATA
contig4,ACTTATATATATATA
contig5,ACTTTATATATT

Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:

BEGIN { Actions before reading the file}
{Actions for everyline in the file}
END { Actions after reading the file }

For example,
$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv
Header,Sequence
contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2,ACTTTATATATT
contig3,ACTTATATATATATA
contig4,ACTTATATATATATA
contig5,ACTTTATATATT
-------
We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths > 14:

$ awk '{print (length($2)>14) ? $0">14" : $0"<=14";}' data/test.tsv
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG>14
contig2 ACTTTATATATT<=14
contig3 ACTTATATATATATA>14
contig4 ACTTATATATATATA>14
contig5 ACTTTATATATT<=14
We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:

$ awk 'NR==3{$0=$1}1' data/test.tsv
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2 ACTTTATATATT
contig3
contig4 ACTTATATATATATA
contig5 ACTTTATATATT
You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),

$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv
contig1 contig1 contig1
contig2 contig2 contig2
contig3 contig3 contig3
contig4 contig4 contig4
contig5 contig5 contig5
Although, we can also skip executing later blocks for a given line by using next keyword:

$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv
contig1 contig1
contig2 contig2
contig3
contig4 contig4
contig5 contig5

$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv
contig1 contig1
contig2 contig2

contig4 contig4
contig5 contig5
You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:

$ awk 'BEGIN{while((getline k <"data/test.tsv")>0) print "BEGIN:"k}{print}' data/test.tsv
BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
BEGIN:contig2 ACTTTATATATT
BEGIN:contig3 ACTTATATATATATA
BEGIN:contig4 ACTTATATATATATA
BEGIN:contig5 ACTTTATATATT
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2 ACTTTATATATT
contig3 ACTTATATATATATA
contig4 ACTTATATATATATA
contig5 ACTTTATATATT
You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:

$ awk '{i[$1]=1}END{for (j in i) print j"<="i[j]}' data/test.tsv
contig1<=1
contig2<=1
contig3<=1
contig4<=1
contig5<=1

If you have a license key for Modeller 8 or 9, there is no need to reregister for Modeller 9.13 - the same license key will work. (It won't do any harm to reregister if you want to, though!)

9.13 is primarily a bugfix release relative to the last public release(9.12). Major user-visible changes include:

# Modeller now includes a variety of SOAP (statistically optimized atomic potential) scores for assessing proteins, loops, and interfaces.

# The Lennard-Jones interaction energy is now artificially truncated at very short distance; this makes simulations with poor starting conditions much less likely to 'blow up'.

# model.get_insertions(), model.get_deletions() and model.loops() now have an include_termini option; if False, residue ranges that include chain termini are excluded from the output.

See the Modeller manual for a full change log: http://salilab.org/modeller/9.13/manual/node39.html

If you encounter bugs in Modeller 9.13, please see http://salilab.org/modeller/9.13/manual/node10.html for information on how to report them.

Reference:

http://salilab.org/modeller/

https://edu.t-bio.info/collaborative-model-bioinformatics-education-combining-biologically-inspired-bioinformatics-project-based-learning/

Bioinformatician are not anti-social; We are just genome friendly.

Bioinformatician would love to change the biological world, but they won't give us the genetic code :P

If at first you don't succeed; call it version 1.0

The glass is neither half-full nor half-empty: it's actually have several genomes.

I'm BioGeek.

Fedup with LIPS, try God script.

Idiot, Go ahead, make my data!

Thank god, my genome just compiled.

Error message: "Out of space on genome drive:"

Shut up mobile elements, or i'll flush you out.

Never underestimate the internet bandwidth, u gotta incomplete.

Applied fuzzy logic to understand God's logic?

Warning! Overflow, delete chromosome !

Be nice to the BioGeek, for all you know they might be the next curator!

Beware of computational biologist they screw genes and protein.

Warning! Your genome is full of garbage, delete it !

Bad or missing mouse genome. Spank the cat? (Y/N)

Genome make very fast, very accurate mistakes.

Let's BLAST it.

Some genome never has transposons. It just develops random features.

Go watch CINEMA and have BLAST.