National Institute of Biologicals (NIB), Noida invites applications to recruit on vacant posts of Scientist, Training Officer, Administrative Assistant, Stenographer, Junior Engineer, Computer Operator etc. Applications against these Government Jobs can be submitted on or before 01 July 2015.

NIB Vacancy 2015 Details
1. Scientist Grade III – 06
Qualification: PG degree in the concern field.
Age Limit: 35 Years

2. Junior Scientist – 07
Qualification: M.Sc. in Microbiology / Clinical Microbiology / Biotechnology/ Bioinformatics/ Biochemistry/Bacteriology/Pharmacology/ Serology / Molecular Biology/Physiology from any recognized University with at least 60% marks.
Age Limit: 30 Years

How to Apply: Duly filled-in applications in prescribed application format along with copies of required documents should be reach to: Administrative Officer, National Institute of Biologicals (Ministry of Health & Family Welfare), A-32, Sector-62, Institutional Area, Noida-201309. Click here to obtain application form.

The Last Date to apply to NIB Job is 01 July 2015.

Click here to view details http://nib.gov.in/Advt%20%20%2824.04.2015%29.pdf

Title of project- "Analysis of the structures of known antimicrobial peptides using machine learning algorithms and molecular dynamics simulations".
Name of the Post- Senior Research Fellow
No. of vacancy- One
Stipend- Rs. 14000/ +30% HRA
Essential qualification- Candidate should be having M.Sc. degree in Life Sciences / Bioinformatics / Pharmacology/ Chemistry or any other relevant area of Biology and 2 years of research experience.
Desirable- Candidate with Good knowledge of protein structures, docking, MD simulations will be preferred.
Age Limit- Not exceeding 35 Years
Duration of project- Upto April 2016
How to Apply- Interested candidates can download the application form from below mentioned link- http://www.nirrh.res.in/links/BiodataForm.pdf
Candidate must bring the filled up application form along with all the relevant documents in original and one set of attested photocopies of the same and one passport size recent colour photograph.

Ref. - http://www.nirrh.res.in/links/job_jrf-srf.htm

Research Fellows Systems Biology job vacancy in C.R.Rao Advanced Institute of Mathematics, Statistics and Computer Science (AIMSCS)

JRF : Qualification - M. Sc in Bioinformatics, Systems Biology, M. Sc statistics, or M. Tech in Bioinformatics,

Pay Scale : Rs. 25,000

SRF : Qualification- Qualification prescribed for JRF with 2 years of research experience.

Pay Scale : Rs. 28,000*

No.of Post: 2

Desirable: Candidates should have strong background in Computational biology, bioinformatics, statistics and algorithmic development. In addition to that previous experience of working on Linux, bio-informatics, NGS data analysis and Basic knowledge of biology is desirable. Programming on any one of the programming languages (C, C++, perl, python) and statistical framework (e.g. R, matlab, etc.) is highly desirable.

More at http://www.crraoaimscs.org/jrf_application_form_2015.pdf

Human genetic variation
Inference of human evolutionary history from genetic markers
Statistical analysis of population-genetic data
Mathematical models of gene genealogies
Theoretical population genetics
Combinatorics of evolutionary trees
The relationship between gene trees and species trees
The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility
More at https://web.stanford.edu/group/rosenberglab/index.html

Pakyong

F.No:NRCO/Admn/DBT /136 /

Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.

‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”

Junior Research Fellow (One post)

Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.

Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques

2nd June 2015

Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl