Effective July 10, 2023, NCBI’s Assembly and Genome record pages now redirect to new NCBI Datasets pages. As previously announced, these updates are part of our ongoing effort to modernize and improve your user experience. NCBI Datasets is a new resource that makes it easier to find and download genome data.   

The following pages have been updated:

• The NCBI Assembly record pages now redirect to the new NCBI Datasets Genome record pages that describe assembled genomes and provide links to related NCBI tools such as Genome Data Viewer and BLAST.  
• The NCBI Genome record pages now redirect to the NCBI Datasets Taxonomy record pages that provide a taxonomy-focused portal to genes, genomes, and additional NCBI resources.   

During this transition, you will have the option to return to the legacy Genome and Assembly record pages. We will remove the legacy pages in early 2024.  

Title of project- "Analysis of the structures of known antimicrobial peptides using machine learning algorithms and molecular dynamics simulations".
Name of the Post- Senior Research Fellow
No. of vacancy- One
Stipend- Rs. 14000/ +30% HRA
Essential qualification- Candidate should be having M.Sc. degree in Life Sciences / Bioinformatics / Pharmacology/ Chemistry or any other relevant area of Biology and 2 years of research experience.
Desirable- Candidate with Good knowledge of protein structures, docking, MD simulations will be preferred.
Age Limit- Not exceeding 35 Years
Duration of project- Upto April 2016
How to Apply- Interested candidates can download the application form from below mentioned link- http://www.nirrh.res.in/links/BiodataForm.pdf
Candidate must bring the filled up application form along with all the relevant documents in original and one set of attested photocopies of the same and one passport size recent colour photograph.

Ref. - http://www.nirrh.res.in/links/job_jrf-srf.htm

Research Fellows Systems Biology job vacancy in C.R.Rao Advanced Institute of Mathematics, Statistics and Computer Science (AIMSCS)

JRF : Qualification - M. Sc in Bioinformatics, Systems Biology, M. Sc statistics, or M. Tech in Bioinformatics,

Pay Scale : Rs. 25,000

SRF : Qualification- Qualification prescribed for JRF with 2 years of research experience.

Pay Scale : Rs. 28,000*

No.of Post: 2

Desirable: Candidates should have strong background in Computational biology, bioinformatics, statistics and algorithmic development. In addition to that previous experience of working on Linux, bio-informatics, NGS data analysis and Basic knowledge of biology is desirable. Programming on any one of the programming languages (C, C++, perl, python) and statistical framework (e.g. R, matlab, etc.) is highly desirable.

More at http://www.crraoaimscs.org/jrf_application_form_2015.pdf

We are also interested in the large-scale integration of genomic, expression, methylation and proteomic data sets, as well as the application of whole genome sequence analysis in clinical diagnostics.

More at http://millslab.ccmb.med.umich.edu/index.html

Pakyong

F.No:NRCO/Admn/DBT /136 /

Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.

‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”

Junior Research Fellow (One post)

Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.

Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques

2nd June 2015

Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

Qualifications : Ph. D.

Desirable : Experience on DNA Markers, plant genome mapping and bioinformatics

No. of Post : 03

Department : Genetics

Salary : Rs. 60,000/-
How to apply

The applicants are requested to register their names on the day of interview in the First Floor, Biotech Centre, Centre for Genetic Manipulation of Crop Plants, Department of Genetics before the stipulated time for the interview. Only the registered eligible candidates will be interviewed on the day in the Committee Room. Applicants are requested to bring all related documents, in original and a set of photocopy, for verification. Date and time of the interview : 25.06.2015 at 10:30 AM.

Click Here for Job Details http://www.du.ac.in/du/index.php?mact=News,cntnt01,detail,0&cntnt01articleid=5492&cntnt01returnid=83