BOL: Related items

Steps to find all the repeats in the genome !

Neel — Thu, 31 Aug 2023 02:43:28 -0500

To find repeats in a genome from 2 to 9 length using a Perl script, you can use the RepeatMasker tool with the "--length" option[0]. Here's a step-by-step guide:

Install RepeatMasker: First, you need to install RepeatMasker on your system. You can download it from the RepeatMasker website[0].

Prepare the genome sequence: Make sure you have the genome sequence in a FASTA file format. Let's assume the file is named "genome.fasta".

./RepeatMasker -pa -nolow -norna -no_is -div -lib RepeatMaskerLib.embl -gff -xsmall -small -poly -species -dir -length - genome.fasta

Replace the following placeholders with appropriate values:

: The number of processors/threads you want to use for parallel processing.
: The divergence value for the species you are analyzing. You can find divergence values for different species in the RepeatMasker documentation[0].
: The name of the species you are analyzing.
: The directory where you want the output files to be saved.
and : The minimum and maximum lengths of the repeats you want to find (in this case, 2 and 9).

Analyze the output: RepeatMasker will generate several output files, including a .out file. You can parse this file to extract the information you need. There is a Perl tool called "one_code_to_find_them_all.pl" that can help you parse RepeatMasker output files[0]. You can download it from the source provided.

Use the provided Perl script: Once you have the "one_code_to_find_them_all.pl" script, you can run it to conveniently parse the RepeatMasker output files. Here's an example of how to use it:

perl one_code_to_find_them_all.pl --rm --length

Replace with the path to your RepeatMasker .out file, and with the path to a file containing the lengths of the reference elements.

This script will generate several output files, including .log.txt and .copynumber.csv, which contain quantitative information about the identified repeat elements.

Remember to adjust the parameters and options according to your specific needs and the characteristics of your genome.

DFAST: a flexible prokaryotic genome annotation pipeline for faster genome publication

Jit — Tue, 14 Nov 2017 10:26:16 -0600

We developed a prokaryotic genome annotation pipeline, DFAST, that also supports genome submission to public sequence databases. DFAST was originally started as an on-line annotation server, and to date, over 7,000 jobs have been processed since its first launch in 2016. Here, we present a newly implemented background annotation engine for DFAST, which is also available as a standalone command-line program. The new engine can annotate a typical-sized bacterial genome within 10 minutes, with rich information such as pseudogenes, translation exceptions, and orthologous gene assignment between given reference genomes. In addition, the modular framework of DFAST allows users to customize the annotation workflow easily and will also facilitate extensions for new functions and incorporation of new tools in the future.

Availability and Implementation

The software is implemented in Python 3 and runs in both Python 2.7 and 3.4– on Macintosh and Linux systems. It is freely available at https://github.com/nigyta/dfast_core/ under the GPLv3 license with external binaries bundled in the software distribution. An on-line version is also available at https://dfast.nig.ac.jp/.

Address of the bookmark: https://dfast.nig.ac.jp/

mScaffolder: A comparative genome scaffolding tool

Jit — Fri, 15 Jun 2018 04:48:01 -0500

A comparative genome scaffolding tool based on MUMmer

mScaffolder scaffolds a genome using an existing high quality genome as the reference. It aligns the two genomes using nucmer utility from MUMmer and then orders and orients the contigs of the candidate genome guided by their alignments to the reference genome. Please send your questions and comments to mchakrab@uci.edu.

Citation https://www.nature.com/articles/s41588-017-0010-y

Address of the bookmark: https://github.com/mahulchak/mscaffolder

VCF Compare !

Rahul Nayak — Wed, 19 Jan 2022 10:30:14 -0600

compare two BWA mapping methods with the online hg18-mapped data

We first operate a rapid inspection of the different BAM files using samtools flagstat. Illumina provided chr21 read mapping obtained with their GA IIx deep sequencing platform <ftp://webdata:webdata@ussd-ftp.illumina.com/Data/SequencingRuns/NA18507_GAIIx_100_chr21.bam>, aligned to the b36/hg18 reference genome)

Address of the bookmark: https://wiki.bits.vib.be/index.php/NGS_Exercise.6#compare_aln_.26_mem_results_with_vcf-compare

fragScaff: Genome Assembly with Contiguity Preserving Transposition

Jit — Mon, 14 May 2018 04:28:14 -0500

Contiguity preserving transposition and sequencing (CPT-seq) is an entirely in vitro means of generating libraries comprised of 9216 indexed pools, each of which contains thousands of sparsely sequenced long fragments ranging from 5 kilobases to >1 megabase. This software, fragScaff, leverages coincidences between the content of different pools as a source of contiguity information for scaffolding de novo genome assemblies. FragScaff is complementary to Lachesis, providing midrange contiguity to support robust, accurate chromosome-scale de novo genome assemblies without the need for laborious in vivo cloning steps.

Further information about fragScaff, including source code, is available at:https://sourceforge.net/projects/fragscaff/files.

Manuscript describing fragScaff was published as: Adey A, Kitzman JO, Burton JN, Daza R, Kumar A, Christiansen L, Ronaghi M, Amini S, L Gunderson K, Steemers FJ, Shendure J#. In vitro, long-range sequence information for de novo genome assembly via transposase contiguity. Genome Research 2014 Dec;24(12):2041-9. doi: 10.1101/gr.178319.114. PubMed PMID: 25327137.

Address of the bookmark: https://sourceforge.net/projects/fragscaff/files/

LINKS scaffolder bloomfilter setting !

Jit — Fri, 15 Jun 2018 10:39:54 -0500

➜ bin git:(master) ✗ ls -l
total 68
drwxrwxr-x 3 urbe urbe 4096 Jun 15 12:15 lib
-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS
➜ bin git:(master) ✗ pwd
/home/urbe/Tools/LINKS_1.8.6/bin

➜ bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i
➜ bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory
compilation terminated.
➜ bloomfilter git:(master) ✗ cd swig
➜ swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
In file included from BloomFilter_wrap.cxx:1877:0:
../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:
../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]
fread(&header, sizeof(struct FileHeader), 1, file);
^
➜ swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3
➜ swig git:(master) ✗ cd ..
➜ bloomfilter git:(master) ✗ cd ..
➜ lib git:(master) ✗ cd ..
➜ bin git:(master) ✗ ./LINKS
Usage: ./LINKS [v1.8.6]
-f sequences to scaffold (Multi-FASTA format, required)
-s file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)
-m MPET reads (default -m 1 = yes, default = no, optional)
! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s
! Paired MPET reads in their original outward orientation <- -> must be separated by ":"
>template_name
ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC
-d distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)
Multiple distances are separated by comma. eg. -d 500,1000,2000,3000
-k k-mer value (default -k 15, optional)
-t step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)
Multiple steps are separated by comma. eg. -t 10,5
-o offset position for extracting k-mer pairs (default -o 0, optional)
-e error (%) allowed on -d distance e.g. -e 0.1 == distance +/- 10% (default -e 0.1, optional)
-l minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)
-a maximum link ratio between two best contig pairs (default -a 0.3, optional)
*higher values lead to least accurate scaffolding*
-z minimum contig length to consider for scaffolding (default -z 500, optional)
-b base name for your output files (optional)
-r Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)
NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE
IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)
-p Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)
-x Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)
-v Runs in verbose mode (-v 1 = yes, default = no, optional)

Error: Missing mandatory options -f and -s.

ERROR fixed

perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr

Genome U-Plot: a whole genome visualization

Rahul Nayak — Fri, 13 Jul 2018 19:50:41 -0500

Genome U-Plot for producing clear and intuitive graphs that allows researchers to generate novel insights and hypotheses by visualizing SVs such as deletions, amplifications, and chromoanagenesis events. The main features of the Genome U-Plot are its layered layout, its high spatial resolution and its improved aesthetic qualities.

https://github.com/gaitat/GenomeUPlot

Address of the bookmark: https://github.com/gaitat/GenomeUPlot

GRSR: a tool for deriving genome rearrangement scenarios from multiple unichromosomal genome sequences

Jit — Fri, 28 Sep 2018 09:35:10 -0500

GRSR is a Tool for Deriving Genome Rearrangement Scenarios for Multiple Uni-chromosomal Genomes. This tool will do the following steps:

Step 1. Run mugsy to get multiple sequence alignment results.
Step 2 & 3. Extraction of the Coordinates of Core Blocks, Construction of Synteny Blocks and Generating Signed Permutations.
Step 4. Generate pairwise genome rearrangement scenarios and find repeats at the breakpoints of each rearrangement events.

https://github.com/DanwangJessica/GRSR

Address of the bookmark: https://github.com/DanwangJessica/GRSR

LINKS

Jit — Fri, 04 Nov 2016 06:19:01 -0500

LINKS is a genomics application for scaffolding genome assemblies with long reads, such as those produced by Oxford Nanopore Technologies Ltd. It can be used to scaffold high-quality draft genome assemblies with any long sequences (eg. ONT reads, PacBio reads, another draft genomes, etc)

Paper at https://gigascience.biomedcentral.com/articles/10.1186/s13742-015-0076-3

Address of the bookmark: https://github.com/warrenlr/LINKS/

SGA: String Graph Assembler

Jit — Thu, 08 Dec 2016 05:08:59 -0600

SGA is a de novo genome assembler based on the concept of string graphs. The major goal of SGA is to be very memory efficient, which is achieved by using a compressed representation of DNA sequence reads.

More at

https://github.com/jts/sga

SGA dependencies:
-google sparse hash library (http://code.google.com/p/google-sparsehash/)
-the bamtools library (https://github.com/pezmaster31/bamtools)
-zlib (http://www.zlib.net/)
-(optional but suggested) the jemalloc memory allocator (http://www.canonware.com/jemalloc/download.html)

Address of the bookmark: https://github.com/jts/sga