<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/88?offset=10</link>
	<atom:link href="https://bioinformaticsonline.com/related/88?offset=10" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/40465/airlift-a-methodology-and-tool-for-comprehensively-moving-mappings-and-annotations-from-one-genome-to-another-similar-genome</guid>
	<pubDate>Mon, 23 Dec 2019 10:20:13 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/40465/airlift-a-methodology-and-tool-for-comprehensively-moving-mappings-and-annotations-from-one-genome-to-another-similar-genome</link>
	<title><![CDATA[AirLift, a methodology and tool for comprehensively moving mappings and annotations from one genome to another similar genome]]></title>
	<description><![CDATA[<p>We propose AirLift, a methodology and tool for comprehensively moving mappings and annotations from one genome to another similar genome while maintaining the accuracy of a full mapper.</p><p>Address of the bookmark: <a href="https://github.com/CMU-SAFARI/AirLift" rel="nofollow">https://github.com/CMU-SAFARI/AirLift</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43711/vcf-compare</guid>
	<pubDate>Wed, 19 Jan 2022 10:30:14 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43711/vcf-compare</link>
	<title><![CDATA[VCF Compare !]]></title>
	<description><![CDATA[<h2><span>compare two&nbsp;<strong>BWA</strong>&nbsp;mapping methods with the online hg18-mapped data</span></h2>
<p>We first operate a rapid inspection of the different BAM files using&nbsp;<strong>samtools flagstat</strong>. Illumina provided chr21 read mapping obtained with their&nbsp;<strong>GA IIx</strong>&nbsp;deep sequencing platform &lt;<a href="ftp://webdata:webdata@ussd-ftp.illumina.com/Data/SequencingRuns/NA18507_GAIIx_100_chr21.bam" target="_blank">ftp://webdata:webdata@ussd-ftp.illumina.com/Data/SequencingRuns/NA18507_GAIIx_100_chr21.bam</a>&gt;, aligned to the b36/hg18 reference genome)</p><p>Address of the bookmark: <a href="https://wiki.bits.vib.be/index.php/NGS_Exercise.6#compare_aln_.26_mem_results_with_vcf-compare" rel="nofollow">https://wiki.bits.vib.be/index.php/NGS_Exercise.6#compare_aln_.26_mem_results_with_vcf-compare</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/11181/perl-one-liner-for-bioinformatician</guid>
	<pubDate>Fri, 30 May 2014 05:49:07 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/11181/perl-one-liner-for-bioinformatician</link>
	<title><![CDATA[Perl one-liner for bioinformatician !!!]]></title>
	<description><![CDATA[<p>With the emergence of NGS technologies, and sequencing data most of the bioinformaticians mung and wrangle around massive amounts of genomics text. There are several "standardized" file formats (FASTQ, SAM, VCF, etc.) and some tools for manipulating them (fastx toolkit, samtools, vcftools, etc.), there are still times where knowing a little bit of Perl onliner is extremely helpful.</p><p>Perl one-liners are small and awesome Perl programs that fit in a single line of code and they do one thing really well. These things include changing line spacing, numbering lines, doing calculations, converting and substituting text, deleting and printing certain lines, parsing logs, editing files in-place, doing statistics, carrying out system administration tasks, updating a bunch of files at once, and many more. Perl one-liners will make you the shell warrior. Anything that took you minutes to solve, will now take you seconds!<br /><br />perl -pe '$\="\n"'&nbsp; &nbsp;<br />#double space a file<br /><br />perl -pe '$_ .= "\n" unless /^$/' <br />#double space a file except blank lines<br /><br />perl -pe '$_.="\n"x7' <br />#7 space in a line.<br /><br />perl -ne 'print unless /^$/' <br />#remove all blank lines<br /><br />perl -lne 'print if length($_) &lt; 20' <br />#print all lines with length less than 20.<br /><br />perl -00 -pe '' <br />#If there are multiple spaces, delete all leaving one(make the file a single spaced file).<br /><br />perl -00 -pe '$_.="\n"x4' <br />#Expand single blank lines into 4 consecutive blank lines<br /><br />perl -pe '$_ = "$. $_"'<br />#Number all lines in a file<br /><br />perl -pe '$_ = ++$a." $_" if /./' <br />#Number only non-empty lines in a file<br /><br />perl -ne 'print ++$a." $_" if /./' <br />#Number and print only non-empty lines in a file<br /><br />perl -pe '$_ = ++$a." $_" if /regex/' <br />#Number only lines that match a pattern<br /><br />perl -ne 'print ++$a." $_" if /regex/' <br />#Number and print only lines that match a pattern<br /><br />perl -ne 'printf "%-5d %s", $., $_ if /regex/' <br />#Left align lines with 5 white spaces if matches a pattern (perl -ne 'printf "%-5d %s", $., $_' : for all the lines)<br /><br />perl -le 'print scalar(grep{/./}&lt;&gt;)' <br />#prints the total number of non-empty lines in a file<br /><br />perl -lne '$a++ if /regex/; END {print $a+0}' <br />#print the total number of lines that matches the pattern<br /><br />perl -alne 'print scalar @F' <br />#print the total number fields(words) in each line.<br /><br />perl -alne '$t += @F; END { print $t}' <br />#Find total number of words in the file<br /><br />perl -alne 'map { /regex/ &amp;&amp; $t++ } @F; END { print $t }' <br />#find total number of fields that match the pattern<br /><br />perl -lne '/regex/ &amp;&amp; $t++; END { print $t }' <br />#Find total number of lines that match a pattern<br /><br />perl -le '$n = 20; $m = 35; ($m,$n) = ($n,$m%$n) while $n; print $m' <br />#will calculate the GCD of two numbers.<br /><br />perl -le '$a = $n = 20; $b = $m = 35; ($m,$n) = ($n,$m%$n) while $n; print $a*$b/$m' <br />#will calculate lcd of 20 and 35.<br /><br />perl -le '$n=10; $min=5; $max=15; $, = " "; print map { int(rand($max-$min))+$min } 1..$n' <br />#Generates 10 random numbers between 5 and 15.<br /><br />perl -le 'print map { ("a".."z",&rdquo;0&rdquo;..&rdquo;9&rdquo;)[rand 36] } 1..8'<br />#Generates a 8 character password from a to z and number 0 &ndash; 9.<br /><br />perl -le 'print map { ("a",&rdquo;t&rdquo;,&rdquo;g&rdquo;,&rdquo;c&rdquo;)[rand 4] } 1..20'<br />#Generates a 20 nucleotide long random residue.<br /><br />perl -le 'print "a"x50'<br />#generate a string of &lsquo;x&rsquo; 50 character long<br /><br />perl -le 'print join ", ", map { ord } split //, "hello world"'<br />#Will print the ascii value of the string hello world.<br /><br />perl -le '@ascii = (99, 111, 100, 105, 110, 103); print pack("C*", @ascii)'<br />#converts ascii values into character strings.<br /><br />perl -le '@odd = grep {$_ % 2 == 1} 1..100; print "@odd"'<br />#Generates an array of odd numbers.<br /><br />perl -le '@even = grep {$_ % 2 == 0} 1..100; print "@even"'<br />#Generate an array of even numbers<br /><br />perl -lpe 'y/A-Za-z/N-ZA-Mn-za-m/' file <br />#Convert the entire file into 13 characters offset(ROT13)<br /><br />perl -nle 'print uc' <br />#Convert all text to uppercase:<br /><br />perl -nle 'print lc' <br />#Convert text to lowercase:<br /><br />perl -nle 'print ucfirst lc' <br />#Convert only first letter of first word to uppercas<br /><br />perl -ple 'y/A-Za-z/a-zA-Z/' <br />#Convert upper case to lower case and vice versa<br /><br />perl -ple 's/(\w+)/\u$1/g' <br />#Camel Casing<br /><br />perl -pe 's|\n|\r\n|' <br />#Convert unix new lines into DOS new lines:<br /><br />perl -pe 's|\r\n|\n|' <br />#Convert DOS newlines into unix new line<br /><br />perl -pe 's|\n|\r|' <br />#Convert unix newlines into MAC newlines:<br /><br />perl -pe '/regexp/ &amp;&amp; s/foo/bar/' <br />#Substitute a foo with a bar in a line with a regexp.</p><p>Reference/Sources:</p><p>http://genomics-array.blogspot.in/2010/11/some-unixperl-oneliners-for.html</p><p><a href="http://genomespot.blogspot.com/2013/08/a-selection-of-useful-bash-one-liners.html">http://genomespot.blogspot.com/2013/08/a-selection-of-useful-bash-one-liners.html</a></p><p><a href="http://biowize.wordpress.com/2012/06/15/command-line-magic-for-your-gene-annotations/">http://biowize.wordpress.com/2012/06/15/command-line-magic-for-your-gene-annotations/</a></p><p><a href="http://genomics-array.blogspot.com/2010/11/some-unixperl-oneliners-for.html">http://genomics-array.blogspot.com/2010/11/some-unixperl-oneliners-for.html</a></p><p><a href="http://bioexpressblog.wordpress.com/2013/04/05/split-multi-fasta-sequence-file/">http://bioexpressblog.wordpress.com/2013/04/05/split-multi-fasta-sequence-file/</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34328/dfast-a-flexible-prokaryotic-genome-annotation-pipeline-for-faster-genome-publication</guid>
	<pubDate>Tue, 14 Nov 2017 10:26:16 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34328/dfast-a-flexible-prokaryotic-genome-annotation-pipeline-for-faster-genome-publication</link>
	<title><![CDATA[DFAST: a flexible prokaryotic genome annotation pipeline for faster genome publication]]></title>
	<description><![CDATA[<p>We developed a prokaryotic genome annotation pipeline, DFAST, that also supports genome submission to public sequence databases. DFAST was originally started as an on-line annotation server, and to date, over 7,000 jobs have been processed since its first launch in 2016. Here, we present a newly implemented background annotation engine for DFAST, which is also available as a standalone command-line program. The new engine can annotate a typical-sized bacterial genome within 10 minutes, with rich information such as pseudogenes, translation exceptions, and orthologous gene assignment between given reference genomes. In addition, the modular framework of DFAST allows users to customize the annotation workflow easily and will also facilitate extensions for new functions and incorporation of new tools in the future.</p>
<div>Availability and Implementation</div>
<p>The software is implemented in Python 3 and runs in both Python 2.7 and 3.4&ndash; on Macintosh and Linux systems. It is freely available at&nbsp;<a href="https://github.com/nigyta/dfast_core/" target="">https://github.com/nigyta/dfast_core/</a>&nbsp;under the GPLv3 license with external binaries bundled in the software distribution. An on-line version is also available at&nbsp;<a href="https://dfast.nig.ac.jp/" target="">https://dfast.nig.ac.jp/</a>.</p><p>Address of the bookmark: <a href="https://dfast.nig.ac.jp/" rel="nofollow">https://dfast.nig.ac.jp/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36954/mscaffolder-a-comparative-genome-scaffolding-tool</guid>
	<pubDate>Fri, 15 Jun 2018 04:48:01 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36954/mscaffolder-a-comparative-genome-scaffolding-tool</link>
	<title><![CDATA[mScaffolder: A comparative genome scaffolding tool]]></title>
	<description><![CDATA[<p>A comparative genome scaffolding tool based on MUMmer</p>
<p>mScaffolder scaffolds a genome using an existing high quality genome as the reference. It aligns the two genomes using nucmer utility from MUMmer and then orders and orients the contigs of the candidate genome guided by their alignments to the reference genome. Please send your questions and comments to&nbsp;<a href="mailto:mchakrab@uci.edu">mchakrab@uci.edu</a>.</p>
<p><span>Citation</span><span>&nbsp;</span><a href="https://www.nature.com/articles/s41588-017-0010-y">https://www.nature.com/articles/s41588-017-0010-y</a></p><p>Address of the bookmark: <a href="https://github.com/mahulchak/mscaffolder" rel="nofollow">https://github.com/mahulchak/mscaffolder</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37306/genome-u-plot-a-whole-genome-visualization</guid>
	<pubDate>Fri, 13 Jul 2018 19:50:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37306/genome-u-plot-a-whole-genome-visualization</link>
	<title><![CDATA[Genome U-Plot: a whole genome visualization]]></title>
	<description><![CDATA[<p><span>Genome U-Plot for producing clear and intuitive graphs that allows researchers to generate novel insights and hypotheses by visualizing SVs such as deletions, amplifications, and chromoanagenesis events. The main features of the Genome U-Plot are its layered layout, its high spatial resolution and its improved aesthetic qualities.&nbsp;</span></p>
<p><span>https://github.com/gaitat/GenomeUPlot</span></p><p>Address of the bookmark: <a href="https://github.com/gaitat/GenomeUPlot" rel="nofollow">https://github.com/gaitat/GenomeUPlot</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37796/grsr-a-tool-for-deriving-genome-rearrangement-scenarios-from-multiple-unichromosomal-genome-sequences</guid>
	<pubDate>Fri, 28 Sep 2018 09:35:10 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37796/grsr-a-tool-for-deriving-genome-rearrangement-scenarios-from-multiple-unichromosomal-genome-sequences</link>
	<title><![CDATA[GRSR: a tool for deriving genome rearrangement scenarios from multiple unichromosomal genome sequences]]></title>
	<description><![CDATA[<p>GRSR is a Tool for Deriving Genome Rearrangement Scenarios for Multiple Uni-chromosomal Genomes. This tool will do the following steps:</p>
<ul>
<li>Step 1. Run mugsy to get multiple sequence alignment results.</li>
<li>Step 2 &amp; 3. Extraction of the Coordinates of Core Blocks, Construction of Synteny Blocks and Generating Signed Permutations.</li>
<li>Step 4. Generate pairwise genome rearrangement scenarios and find repeats at the breakpoints of each rearrangement events.</li>
<li></li>
<li></li>
</ul>
<p>https://github.com/DanwangJessica/GRSR</p><p>Address of the bookmark: <a href="https://github.com/DanwangJessica/GRSR" rel="nofollow">https://github.com/DanwangJessica/GRSR</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43661/maftools</guid>
	<pubDate>Fri, 17 Dec 2021 03:18:28 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43661/maftools</link>
	<title><![CDATA[maftools]]></title>
	<description><![CDATA[<p>With advances in Cancer Genomics, <a href="https://docs.gdc.cancer.gov/Data/File_Formats/MAF_Format/">Mutation Annotation Format</a> (MAF) is being widely accepted and used to store somatic variants detected. <a href="http://cancergenome.nih.gov">The Cancer Genome Atlas</a> Project has sequenced over 30 different cancers with sample size of each cancer type being over 200. <a href="https://wiki.nci.nih.gov/display/TCGA/TCGA+MAF+Files">Resulting data</a> consisting of somatic variants are stored in the form of <a href="https://docs.gdc.cancer.gov/Data/File_Formats/MAF_Format/">Mutation Annotation Format</a>. This package attempts to summarize, analyze, annotate and visualize MAF files in an efficient manner from either TCGA sources or any in-house studies as long as the data is in MAF format.</p>
<p>https://www.bioconductor.org/packages/devel/bioc/vignettes/maftools/inst/doc/maftools.html</p><p>Address of the bookmark: <a href="https://github.com/PoisonAlien/maftools" rel="nofollow">https://github.com/PoisonAlien/maftools</a></p>]]></description>
	<dc:creator>Surabhi Chaudhary</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/43728/short-read-assembly-using-spades</guid>
	<pubDate>Mon, 31 Jan 2022 07:18:16 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/43728/short-read-assembly-using-spades</link>
	<title><![CDATA[Short-read assembly using Spades !]]></title>
	<description><![CDATA[<h2 id="short-read-assembly-a-comparison">If we only had Illumina reads, we could also assemble these using the tool Spades.</h2><p>You can try this here, or try it later on your own data.</p><h2 id="get-data">Get data</h2><p>We will use the same Illumina data as we used above:</p><ul>
<li>illumina_R1.fastq.gz: the Illumina forward reads</li>
<li>illumina_R2.fastq.gz: the Illumina reverse reads</li>
</ul><h2 id="assemble">Assemble</h2><p>Run Spades:</p><div><pre>spades.py -1 illumina_R1.fastq.gz -2 illumina_R2.fastq.gz --careful --cov-cutoff auto -o spades_assembly_all_illumina
</pre></div><ul>
<li><code>-1</code>&nbsp;is input file of forward reads</li>
<li><code>-2</code>&nbsp;is input file of reverse reads</li>
<li><code>--careful</code>&nbsp;minimizes mismatches and short indels</li>
<li><code>--cov-cutoff auto</code>&nbsp;computes the coverage threshold (rather than the default setting, &ldquo;off&rdquo;)</li>
<li><code>-o</code>&nbsp;is the output directory</li>
</ul><h2 id="results">Results</h2><p>Move into the output directory and look at the contigs:</p><div><pre>infoseq contigs.fasta</pre></div>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>

</channel>
</rss>