<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/920?offset=1100</link>
	<atom:link href="https://bioinformaticsonline.com/related/920?offset=1100" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/9868/raghavas-group</guid>
  <pubDate>Tue, 15 Apr 2014 23:59:48 -0500</pubDate>
  <link></link>
  <title><![CDATA[Raghava's Group]]></title>
  <description><![CDATA[
<p>Raghava's group is known for developing open source software or web servers. Group have developed large number of web-based services.</p>

<p>Find more at http://www.imtech.res.in/raghava/</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/43284/tech-and-bioinformatics-roles-at-basepaws</guid>
  <pubDate>Wed, 18 Aug 2021 23:34:25 -0500</pubDate>
  <link></link>
  <title><![CDATA[Tech and Bioinformatics roles at Basepaws]]></title>
  <description><![CDATA[
<p>Basepaws is an LA-based pet genomics company, quickly growing and focused on feline and canine at-home genetic and biome tests, along with many other projects and products in the works. Thank you for taking a look!</p>

<p>Bioinformatics : https://www.linkedin.com/jobs/view/2681785372/</p>

<p>Engineer: https://www.linkedin.com/jobs/view/2681796993/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/44352/bioinformatics-tools-for-genome-assembly</guid>
	<pubDate>Mon, 24 Jul 2023 07:04:26 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/44352/bioinformatics-tools-for-genome-assembly</link>
	<title><![CDATA[Bioinformatics tools for genome assembly !]]></title>
	<description><![CDATA[<p>There are numerous genome assembly tools available, each with its strengths and weaknesses. Here is a list of some widely used genome assembly tools as of my last update in September 2021:</p><ol>
<li>
<p><span>SPAdes:</span> An assembler specifically designed for single-cell and multi-cell bacterial genomes, as well as small eukaryotic genomes.</p>
</li>
<li>
<p><span>ABySS:</span> A parallelized assembler for large genomes that uses de Bruijn graphs.</p>
</li>
<li>
<p><span>Velvet:</span> Another de Bruijn graph-based assembler optimized for short-read sequencing data.</p>
</li>
<li>
<p><span>SOAPdenovo:</span> A de Bruijn graph-based assembler designed for short reads, widely used for assembling large and complex genomes.</p>
</li>
<li>
<p><span>MaSuRCA:</span> A hybrid assembler that combines data from multiple sequencing technologies, such as Illumina and PacBio.</p>
</li>
<li>
<p><span>Canu:</span> A long-read assembler optimized for PacBio and Oxford Nanopore sequencing data.</p>
</li>
<li>
<p><span>Flye:</span> A long-read assembler suitable for bacterial and small eukaryotic genomes.</p>
</li>
<li>
<p><span>SMARTdenovo:</span> An assembler designed for long reads, particularly suited for PacBio data.</p>
</li>
<li>
<p><span>SPAdes Long Read (SPAdesLR):</span> An extension of SPAdes for long-read data, such as those from PacBio or Nanopore.</p>
</li>
<li>
<p><span>Minia:</span> An assembler optimized for low memory consumption, suitable for small and medium-sized genomes.</p>
</li>
<li>
<p><span>Unicycler:</span> A hybrid assembler that combines short and long reads for circular bacterial genome assembly.</p>
</li>
<li>
<p><span>wtdbg2:</span> A de Bruijn graph assembler for long reads, efficient for very large genomes.</p>
</li>
<li>
<p><span>Shasta:</span> A long-read assembler that uses the Overlap-Layout-Consensus approach, suitable for PacBio and Nanopore data.</p>
</li>
<li>
<p><span>Sparc:</span> An assembler designed to handle noisy long reads from Nanopore sequencing.</p>
</li>
<li>
<p><span>CANA:</span> An assembler for metagenomic data, particularly for complex and diverse microbial communities.</p>
</li>
<li>
<p><span>Ra</span> Assembler: A metagenome assembler for long reads, designed for highly complex metagenomic samples.</p>
</li>
</ol><p>Please note that the field of bioinformatics is constantly evolving, and new assembly tools may have emerged since my last update. Additionally, the performance of these tools can vary depending on the characteristics of the sequencing data and the genome being assembled. When selecting an assembly tool, consider the specific requirements of your project, the available data types, and the computational resources at your disposal. Always refer to the respective tool's documentation and publications for the most up-to-date information and recommendations.</p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/44734/data-visualization-in-bioinformatics-useful-and-eye-catching-plots-for-data-analysis</guid>
	<pubDate>Sat, 14 Dec 2024 12:41:53 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/44734/data-visualization-in-bioinformatics-useful-and-eye-catching-plots-for-data-analysis</link>
	<title><![CDATA[Data Visualization in Bioinformatics: Useful and Eye-Catching Plots for Data Analysis]]></title>
	<description><![CDATA[<p>Data visualization is a cornerstone of bioinformatics, enabling researchers to interpret complex datasets effectively. With a plethora of data types&mdash;genomic sequences, expression profiles, protein interactions, and more&mdash;the right visualizations can make or break an analysis. This blog highlights some of the most useful and visually compelling plots for bioinformatics data analysis, along with tools to create them.</p><h4><strong>1. Heatmaps: Exploring Patterns in High-Dimensional Data</strong></h4><p>Heatmaps are a go-to visualization for representing high-dimensional datasets, such as gene expression or metabolomics data. They use color gradients to display data intensity, making patterns and clusters easily detectable.</p><ul>
<li>
<p><strong>Applications</strong>: Gene expression analysis, pathway enrichment, methylation studies.</p>
</li>
<li>
<p><strong>Tools</strong>: Seaborn (Python), ComplexHeatmap (R), Morpheus (web-based).</p>
</li>
</ul><p><strong>Tip</strong>: Add dendrograms to visualize clustering of rows and columns for hierarchical relationships.</p><h4><strong>2. Volcano Plots: Highlighting Differential Features</strong></h4><p>Volcano plots are indispensable for identifying significantly differentially expressed genes or proteins. They plot the log2 fold change against &ndash;log10(p-value), making it easy to spot statistically significant changes.</p><ul>
<li>
<p><strong>Applications</strong>: RNA-seq, proteomics, and metabolomics.</p>
</li>
<li>
<p><strong>Tools</strong>: ggplot2 (R), EnhancedVolcano (R), Plotly (Python).</p>
</li>
</ul><p><strong>Tip</strong>: Use color to highlight significant features and label key genes or proteins.</p><h4><strong>3. PCA Plots: Reducing Complexity with Principal Component Analysis</strong></h4><p>Principal Component Analysis (PCA) plots are used to reduce dimensionality and uncover trends or clusters in data. They provide insights into sample variability and grouping.</p><ul>
<li>
<p><strong>Applications</strong>: Transcriptomics, metabolomics, microbiome studies.</p>
</li>
<li>
<p><strong>Tools</strong>: scikit-learn + Matplotlib (Python), prcomp (R), ClustVis (web-based).</p>
</li>
</ul><p><strong>Tip</strong>: Annotate clusters with metadata to enhance interpretability.</p><h4><strong>4. Manhattan Plots: Genome-Wide Association Studies</strong></h4><p>Manhattan plots visualize p-values across the genome, making it easy to identify significant associations in genome-wide studies. They resemble city skylines, with the highest peaks indicating loci of interest.</p><ul>
<li>
<p><strong>Applications</strong>: GWAS, QTL mapping.</p>
</li>
<li>
<p><strong>Tools</strong>: qqman (R), Matplotlib (Python).</p>
</li>
</ul><p><strong>Tip</strong>: Use alternating colors for chromosomes and highlight significant SNPs for clarity.</p><h4><strong>5. Circular Plots (Circos): Visualizing Genomic Relationships</strong></h4><p>Circular plots are ideal for visualizing relationships across the genome, such as structural variations, gene duplications, or synteny.</p><ul>
<li>
<p><strong>Applications</strong>: Comparative genomics, structural variation studies.</p>
</li>
<li>
<p><strong>Tools</strong>: Circos (standalone), Rcircos (R), pyCircos (Python).</p>
</li>
</ul><p><strong>Tip</strong>: Keep the plot clean and avoid overcrowding to maintain readability.</p><h4><strong>6. Sankey Diagrams: Tracking Data Flows</strong></h4><p>Sankey diagrams visualize flows or relationships between categories, often used to track changes in gene expression or pathway enrichment across conditions.</p><ul>
<li>
<p><strong>Applications</strong>: Pathway analysis, gene set enrichment analysis.</p>
</li>
<li>
<p><strong>Tools</strong>: Plotly (Python), networkD3 (R).</p>
</li>
</ul><p><strong>Tip</strong>: Use gradients or distinct colors to highlight key transitions.</p><h4><strong>7. Network Graphs: Mapping Interactions</strong></h4><p>Network graphs represent relationships between entities, such as protein-protein interactions or gene regulatory networks. Nodes represent entities, and edges represent relationships.</p><ul>
<li>
<p><strong>Applications</strong>: Systems biology, interactomics.</p>
</li>
<li>
<p><strong>Tools</strong>: Cytoscape (standalone), igraph (R), NetworkX (Python).</p>
</li>
</ul><p><strong>Tip</strong>: Use edge thickness or node size to represent interaction strength or centrality.</p><h4><strong>8. Violin Plots: Visualizing Data Distribution</strong></h4><p>Violin plots combine a boxplot with a density plot, showing the distribution and variability of data.</p><ul>
<li>
<p><strong>Applications</strong>: Single-cell RNA-seq, quantitative trait analysis.</p>
</li>
<li>
<p><strong>Tools</strong>: Seaborn (Python), ggplot2 (R).</p>
</li>
</ul><p><strong>Tip</strong>: Split violins by groups for side-by-side comparisons.</p><h4><strong>9. Time-Series Plots: Monitoring Changes Over Time</strong></h4><p>Time-series plots display changes in variables across time points, useful for tracking gene expression dynamics or metabolic fluxes.</p><ul>
<li>
<p><strong>Applications</strong>: Time-course experiments, cell cycle studies.</p>
</li>
<li>
<p><strong>Tools</strong>: Matplotlib (Python), ggplot2 (R).</p>
</li>
</ul><p><strong>Tip</strong>: Smooth the data to highlight trends while avoiding overfitting.</p><h4><strong>10. Genome Tracks: Visualizing Genomic Features</strong></h4><p>Genome tracks display multiple layers of genomic data, such as gene annotations, sequencing coverage, and epigenetic marks.</p><ul>
<li>
<p><strong>Applications</strong>: ChIP-seq, ATAC-seq, whole-genome sequencing.</p>
</li>
<li>
<p><strong>Tools</strong>: IGV (standalone), pyGenomeTracks (Python).</p>
</li>
</ul><p><strong>Tip</strong>: Stack related tracks for direct comparisons.</p><h4><strong>11. UpSet Plots: Visualizing Set Intersections</strong></h4><p>UpSet plots are a powerful alternative to Venn diagrams for visualizing intersections between multiple datasets.</p><ul>
<li>
<p><strong>Applications</strong>: Overlap analysis for gene sets, pathways, or variants.</p>
</li>
<li>
<p><strong>Tools</strong>: UpSetR (R), ComplexUpset (Python).</p>
</li>
</ul><p><strong>Tip</strong>: Use bar plots to represent the size of each intersection for added clarity.</p><h4><strong>12. Ridge Plots: Comparing Distributions</strong></h4><p>Ridge plots visualize the distributions of multiple datasets, stacked for easy comparison.</p><ul>
<li>
<p><strong>Applications</strong>: Transcriptomics, single-cell RNA-seq.</p>
</li>
<li>
<p><strong>Tools</strong>: ggridges (R), Matplotlib (Python).</p>
</li>
</ul><p><strong>Tip</strong>: Use transparency and consistent scaling for better readability.</p><h4><strong>13. Chord Diagrams: Visualizing Connections Between Groups</strong></h4><p>Chord diagrams illustrate relationships between categories, such as shared genes between pathways or overlaps in regulatory elements.</p><ul>
<li>
<p><strong>Applications</strong>: Pathway overlap, synteny, co-expression networks.</p>
</li>
<li>
<p><strong>Tools</strong>: Circlize (R), Holoviews (Python).</p>
</li>
</ul><p><strong>Tip</strong>: Use distinct colors for each group to emphasize relationships.</p><h4><strong>14. Treemaps: Hierarchical Data Representation</strong></h4><p>Treemaps visualize hierarchical data as nested rectangles, with area proportional to data size.</p><ul>
<li>
<p><strong>Applications</strong>: Ontology enrichment, pathway analysis.</p>
</li>
<li>
<p><strong>Tools</strong>: Treemapify (R), Plotly (Python).</p>
</li>
</ul><p><strong>Tip</strong>: Use colors to represent additional variables, like significance or enrichment scores.</p><h4><strong>15. T-SNE/UMAP Plots: Dimensionality Reduction for Clustering</strong></h4><p>T-SNE and UMAP plots are great for visualizing high-dimensional data in two dimensions while preserving local or global structure.</p><ul>
<li>
<p><strong>Applications</strong>: Single-cell transcriptomics, clustering analyses.</p>
</li>
<li>
<p><strong>Tools</strong>: scikit-learn (Python), Seurat (R).</p>
</li>
</ul><p><strong>Tip</strong>: Combine with metadata annotations for better cluster interpretation.</p><h4><strong>Bringing It All Together</strong></h4><p>The choice of visualization can significantly impact the insights gained from bioinformatics data. By selecting plots tailored to your data type and analysis goals, you can effectively communicate your findings and make your research more impactful. Whether you&rsquo;re a seasoned bioinformatician or a beginner, mastering these visualizations will elevate your analyses and presentations.</p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/4094/manufacturing-life-with-j-craig-venter</guid>
	<pubDate>Thu, 29 Aug 2013 08:52:26 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/4094/manufacturing-life-with-j-craig-venter</link>
	<title><![CDATA[Manufacturing Life with J. Craig Venter]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/PKtozMvSsBk" frameborder="0" allowfullscreen></iframe>J. Craig Venter, CEO of Synthetic Genomics, talks about finding genomic-driven solutions to address global needs such as new sources of energy, food and vaccines in an interview with James Bennet, Editor-in-Chief of The Atlantic. This program is introduced by Pradeep Khosla, the new chancellor of the University of California, San Diego.  Series: "The Atlantic Meets The Pacific" [11/2012] [Public Affairs] [Show ID: 24359]
The Atlantic Meets the Pacific playlist: http://goo.gl/5V8Yb
The Atlantic Meets the Pacific on UCTV: http://www.uctv.tv/atlanticpacific
UCTV: http://www.uctv.tv]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/19272/translate2r</guid>
	<pubDate>Fri, 21 Nov 2014 01:16:06 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/19272/translate2r</link>
	<title><![CDATA[translate2R]]></title>
	<description><![CDATA[<p>After their presentation at the international &ldquo;user!&rdquo; conference, data analysis specialist <a href="http://www.eoda.de/en/" target="_blank">eoda</a> starts the public alpha testing of <a href="http://www.eoda.de/en/translate2R.html" target="_blank">translate2R</a>. With the start of alpha testing the innovative migration solution by the company hailing from Kassel discards the working title &ldquo;translateR&rdquo; and takes on the final product brand name &ldquo;translate2R&rdquo;. translate2R is a service for the automated translation of SPSS&reg; syntax to R code, therefore supporting data analysts with a quick and low-risk migration to R.</p><p>The manual translation of many, frequently rather complex SPSS scripts often presents itself as a tedious and error-prone task, and represents a rather large obstacle for many analysts and companies to migrate to a modern, open source data management and analysis tool like R. With translate2R this hurdle will be diminished substantially.</p><p>Find at https://service.eoda.de/translater/?lang=en</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/36191/bioinformatics-workshops-no-coding-required</guid>
	<pubDate>Mon, 09 Apr 2018 13:06:01 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/36191/bioinformatics-workshops-no-coding-required</link>
	<title><![CDATA[Bioinformatics Workshops - NO CODING REQUIRED]]></title>
	<description><![CDATA[<p><img src="https://edu.t-bio.info/wp-content/uploads/2018/03/t-bioinfo-bioinformatics-workshops.jpg" alt="Bioinformatics Workshops T-BioInfo" width="568" height="319" style="vertical-align: middle; border: 0px;"></p><p>Pine Biotech, Inc., a US-based startup working with the Tauber Bioinformatics Research Center is offering a full curriculum online preparing students without any technical background for real-life challenges with large scale biomedical data. Workshops on processing, analysis and biomedical interpretation of Next Generation Sequencing data cover important up-to-date algorithms and machine learning approaches. The most important thing is that there are virtually no pre-requisites such as coding, biostatistics or advanced medical skills. If you know what gene is and how the genes are expressed, you are ready to take the courses or join our workshops. Learn more:&nbsp;https://edu.t-bio.info/workshops/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/12111/internship-program-with-arraygen-technolgies</guid>
  <pubDate>Sun, 22 Jun 2014 23:18:31 -0500</pubDate>
  <link></link>
  <title><![CDATA[Internship program with ArrayGen Technolgies]]></title>
  <description><![CDATA[
<p>Internship Program for Bioinformatics / Biotechnology Professionals Currently we offer positions to outstanding students interested in Next Generation Sequencing (NGS) data analysis. Applications are accepted throughout the year. Accepted students will be listed on web with their schedules. Accepted students can attend our future workshops and trainings freely at the specified venue.</p>

<p>Interested candidates may email their resume along with a cover letter to careers@arraygen.com</p>

<p>Official website: http://www.arraygen.com/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/12883/breaking-chromosomes-to-study-cancer</guid>
	<pubDate>Fri, 18 Jul 2014 05:42:09 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/12883/breaking-chromosomes-to-study-cancer</link>
	<title><![CDATA[Breaking chromosomes to study cancer !!!]]></title>
	<description><![CDATA[<p>Chromosomes are present in every cell of our body and they contain the information the body needs to develop and function properly. This information is carried in genes that are arranged along the chromosomes. There are usually 46 chromosomes in every cell. These chromosomes come in pairs, one from our mother and one from our father. The chromosomes can be sorted into 23 pairs by looking at them down a microscope.</p><p>Most people who have a balanced translocation have the right amount of chromosome material but it has been rearranged in some way. This may happen if two chromosomes swap pieces (a reciprocal translocation). In other cases two whole chromosomes may become stuck together (a Robertsonian translocation). This page describes what happens when someone has a reciprocal translocation. <br /><br />Reciprocal chromosomal translocations occur following double-strand breaks (DSBs) in DNA when a section of one chromosome is exchanged with that of another, non-homologous chromosome. These exchanges may produce a dysfunctional fusion gene that disrupts cell growth and survival pathways, such as the translocations seen in leukemia and childhood sarcomas. <br /><br />Chromosomal translocations have been well studied in cancer cell lines which are associated with two types of cancer, acute myeloid leukemia and Ewing's sarcoma, but determining how they contribute to cancer development is complicated by additional mutations and altered gene expression profiles in these cultured cells. Now, Juan Carlos Ramirez, head of the Viral Vector Facility at the Fundacion Centro Nacional de Investigaciones Cardiovasculares (CNIC) and his colleagues Raul Torres at CNIC and Sandra Rodriguez-Peralez at the Spanish National Cancer Center (CNIO) in Madrid, Spain have used a new genome editing tool, CRISPR-Cas9, to induce chromosomal translocations for the first time in a human cell line and in primary cells. The study's authors conclude by stating that the use of this technology will allow for the clarification of how and why chromosomal translocation occurs, which without doubt will allow new anti-cancer therapeutic strategies to be tackled.</p><p>Using RNA-Guided Endonuclease (RGEN) technology or CRISPR/Cas9 genome engineering technology, CNIO and CNIC researchers have shown that it is possible to obtain such chromosomal translocations. The CRISPR-Cas9 system is extremely simple to introduce a cut at the desired locus, easier to design, and cheaper than many other systems. Using the CRISPR-Cas9 system, Ramirez and his colleagues reproduced the translocations observed in Ewing&rsquo;s Sarcoma (ES) and Acute Myeloid Leukemia (AML) patient cell lines in HEK293 cells and also generated the ES translocation in human mesenchymal stem cells and the AML translocation in umbilical cord blood cells.</p><p>By focusing on chromosomal translocation without the confounding characteristics of established cell lines, these new cells lines should help answer the fundamental question of what causes a cell to become cancerous. Ramirez and his team now look forward to modeling other chromosome translocations in a variety of cell types.</p><p>Reference:</p><p>http://en.wikipedia.org/wiki/Chromosomal_translocation</p><p>http://www.nature.com/ncomms/2014/140603/ncomms4964/abs/ncomms4964.html<br /><br /></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>