<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/926?offset=70</link>
	<atom:link href="https://bioinformaticsonline.com/related/926?offset=70" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/44352/bioinformatics-tools-for-genome-assembly</guid>
	<pubDate>Mon, 24 Jul 2023 07:04:26 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/44352/bioinformatics-tools-for-genome-assembly</link>
	<title><![CDATA[Bioinformatics tools for genome assembly !]]></title>
	<description><![CDATA[<p>There are numerous genome assembly tools available, each with its strengths and weaknesses. Here is a list of some widely used genome assembly tools as of my last update in September 2021:</p><ol>
<li>
<p><span>SPAdes:</span> An assembler specifically designed for single-cell and multi-cell bacterial genomes, as well as small eukaryotic genomes.</p>
</li>
<li>
<p><span>ABySS:</span> A parallelized assembler for large genomes that uses de Bruijn graphs.</p>
</li>
<li>
<p><span>Velvet:</span> Another de Bruijn graph-based assembler optimized for short-read sequencing data.</p>
</li>
<li>
<p><span>SOAPdenovo:</span> A de Bruijn graph-based assembler designed for short reads, widely used for assembling large and complex genomes.</p>
</li>
<li>
<p><span>MaSuRCA:</span> A hybrid assembler that combines data from multiple sequencing technologies, such as Illumina and PacBio.</p>
</li>
<li>
<p><span>Canu:</span> A long-read assembler optimized for PacBio and Oxford Nanopore sequencing data.</p>
</li>
<li>
<p><span>Flye:</span> A long-read assembler suitable for bacterial and small eukaryotic genomes.</p>
</li>
<li>
<p><span>SMARTdenovo:</span> An assembler designed for long reads, particularly suited for PacBio data.</p>
</li>
<li>
<p><span>SPAdes Long Read (SPAdesLR):</span> An extension of SPAdes for long-read data, such as those from PacBio or Nanopore.</p>
</li>
<li>
<p><span>Minia:</span> An assembler optimized for low memory consumption, suitable for small and medium-sized genomes.</p>
</li>
<li>
<p><span>Unicycler:</span> A hybrid assembler that combines short and long reads for circular bacterial genome assembly.</p>
</li>
<li>
<p><span>wtdbg2:</span> A de Bruijn graph assembler for long reads, efficient for very large genomes.</p>
</li>
<li>
<p><span>Shasta:</span> A long-read assembler that uses the Overlap-Layout-Consensus approach, suitable for PacBio and Nanopore data.</p>
</li>
<li>
<p><span>Sparc:</span> An assembler designed to handle noisy long reads from Nanopore sequencing.</p>
</li>
<li>
<p><span>CANA:</span> An assembler for metagenomic data, particularly for complex and diverse microbial communities.</p>
</li>
<li>
<p><span>Ra</span> Assembler: A metagenome assembler for long reads, designed for highly complex metagenomic samples.</p>
</li>
</ol><p>Please note that the field of bioinformatics is constantly evolving, and new assembly tools may have emerged since my last update. Additionally, the performance of these tools can vary depending on the characteristics of the sequencing data and the genome being assembled. When selecting an assembly tool, consider the specific requirements of your project, the available data types, and the computational resources at your disposal. Always refer to the respective tool's documentation and publications for the most up-to-date information and recommendations.</p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44581/biokit-a-set-of-tools-dedicated-to-bioinformatics-data-visualisation</guid>
	<pubDate>Tue, 18 Jun 2024 02:04:39 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44581/biokit-a-set-of-tools-dedicated-to-bioinformatics-data-visualisation</link>
	<title><![CDATA[BioKit: a set of tools dedicated to bioinformatics, data visualisation]]></title>
	<description><![CDATA[<p><span>BioKit is a set of tools dedicated to bioinformatics, data visualisation (</span><a href="https://biokit.readthedocs.io/en/latest/references.html#module-biokit.viz" title="biokit.viz"><code><span>biokit.viz</span></code></a><span>), access to online biological data (e.g. UniProt, NCBI thanks to bioservices). It also contains more advanced tools related to data analysis (e.g.,&nbsp;</span><a href="https://biokit.readthedocs.io/en/latest/references.html#module-biokit.stats" title="biokit.stats"><code><span>biokit.stats</span></code></a><span>). Since R is quite common in bioinformatics, we also provide a convenient module to run R inside your Python scripts or shell (:mod:biokit.rtools module).</span></p><p>Address of the bookmark: <a href="https://biokit.readthedocs.io/en/latest/index.html" rel="nofollow">https://biokit.readthedocs.io/en/latest/index.html</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36514/evidentialgene-tr2aacds-mrna-transcript-assembly-software</guid>
	<pubDate>Tue, 08 May 2018 04:39:39 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36514/evidentialgene-tr2aacds-mrna-transcript-assembly-software</link>
	<title><![CDATA[EvidentialGene: tr2aacds, mRNA Transcript Assembly Software]]></title>
	<description><![CDATA[<p><span>EvidentialGene is a genome informatics project, "Evidence Directed Gene Construction for Eukaryotes", to construct high quality, accurate gene sets for animals and plants, developed by Don Gilbert at Indiana University, see</span><br><a href="http://arthropods.eugenes.org/EvidentialGene/" target="_blank">http://arthropods.eugenes.org/EvidentialGene/<span></span></a><br><br><span>Construction refers to the combination of classical gene prediction, and more recent gene assembly (de-novo and genome-assisted) methods. The basic Evigene methods involve using available best-of-breed gene prediction and assembly software, combining all evidence for genes, from expressed sequences, genome assembly sequences, related species protein sequences, and any other, to annotate and score gene constructions. Over-produced constructions are classified by gene evidence for best qualities per "locus", including genome-aligned and gene-transcript aligned (genome-free) locus identification. All software developed for EvidentialGene is publicly available. See project wiki/blog for notes.</span></p>
<p><span>Download&nbsp;</span></p>
<p>http://arthropods.eugenes.org/EvidentialGene/trassembly.html</p>
<p>https://sourceforge.net/p/evidentialgene/blog/</p><p>Address of the bookmark: <a href="http://arthropods.eugenes.org/EvidentialGene/trassembly.html" rel="nofollow">http://arthropods.eugenes.org/EvidentialGene/trassembly.html</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43364/ragtag-a-collection-of-software-tools-for-scaffolding-and-improving-modern-genome-assemblies</guid>
	<pubDate>Sat, 11 Sep 2021 00:28:14 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43364/ragtag-a-collection-of-software-tools-for-scaffolding-and-improving-modern-genome-assemblies</link>
	<title><![CDATA[RagTag: a collection of software tools for scaffolding and improving modern genome assemblies]]></title>
	<description><![CDATA[<p>RagTag is a collection of software tools for scaffolding and improving modern genome assemblies. Tasks include:</p>
<ul>
<li>Homology-based misassembly&nbsp;<a href="https://github.com/malonge/RagTag/wiki/correct">correction</a></li>
<li>Homology-based assembly&nbsp;<a href="https://github.com/malonge/RagTag/wiki/scaffold">scaffolding</a>&nbsp;and&nbsp;<a href="https://github.com/malonge/RagTag/wiki/patch">patching</a></li>
<li>Scaffold&nbsp;<a href="https://github.com/malonge/RagTag/wiki/merge">merging</a></li>
</ul><p>Address of the bookmark: <a href="https://github.com/malonge/RagTag" rel="nofollow">https://github.com/malonge/RagTag</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/12787/integrative-genomics-viewer-igv-tutorial</guid>
	<pubDate>Sat, 12 Jul 2014 15:16:23 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/12787/integrative-genomics-viewer-igv-tutorial</link>
	<title><![CDATA[Integrative Genomics Viewer (IGV) tutorial]]></title>
	<description><![CDATA[<p>The <a href="http://www.broadinstitute.org/igv/">Integrative Genomics Viewer (IGV)</a> from the Broad Center allows you to view several types of data files involved in any NGS analysis that employs a reference genome, including how reads from a dataset are mapped, gene annotations, and predicted genetic variants.</p>
<p>http://www.broadinstitute.org/igv/</p><p>Address of the bookmark: <a href="https://wikis.utexas.edu/display/bioiteam/Integrative+Genomics+Viewer+%28IGV%29+tutorial" rel="nofollow">https://wikis.utexas.edu/display/bioiteam/Integrative+Genomics+Viewer+%28IGV%29+tutorial</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/27465/stand-alone-programs-for-bioinformatician</guid>
	<pubDate>Sat, 21 May 2016 22:50:15 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/27465/stand-alone-programs-for-bioinformatician</link>
	<title><![CDATA[Stand-alone programs for Bioinformatician]]></title>
	<description><![CDATA[<p>This directory contains applications for stand-alone use, built specifically for a Linux 64-bit machine.</p>
<p>For help on the bigBed and bigWig applications see:<br>http://genome.ucsc.edu/goldenPath/help/bigBed.html<br>http://genome.ucsc.edu/goldenPath/help/bigWig.html</p>
<p>View the file 'FOOTER' to see the usage statement for each of the applications.</p><p>Address of the bookmark: <a href="http://hgdownload.cse.ucsc.edu/admin/exe/linux.x86_64/" rel="nofollow">http://hgdownload.cse.ucsc.edu/admin/exe/linux.x86_64/</a></p>]]></description>
	<dc:creator>Radha Agarkar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/30242/genome-assembly-tools-and-software-part1</guid>
	<pubDate>Mon, 19 Dec 2016 18:09:22 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/30242/genome-assembly-tools-and-software-part1</link>
	<title><![CDATA[Genome Assembly Tools and Software - PART1 !!]]></title>
	<description><![CDATA[<p>The genome assemblers generally take a file of short sequence reads and a file of quality-value as the input. Since the quality-value file for the high throughput short reads is usually highly memory-intensive, only a few assemblers, best suited for your assembly. For the sake of computational memory saving and convenience of data inquiry, high-throughput short reads data is always initially formatted to specific data structure. Currently, existing data structure for this usage can be predominantly classified into two categories: string-based model and graph-based model.</p><p>We therefore list many genomle assembly tools here. We mainly reported for the assembly of genomes while the others are designed aiming at handling complex genomes.</p><ul>
<li><a href="http://microbiology.se/software/trimetass/" title="TriMetAss 1.2 &ndash; The Trinity-based Iterative Metagenomics Assembler">TriMetAss 1.2 &ndash; The Trinity-based Iterative Metagenomics Assembler</a>
<ul>
<li>TriMetAss is an extension to the Trinity software [1], which can assemble select regions surrounding interesting features in metagenomic data. The software is particularly useful for very common and well-conserved genes (and &ndash; in theory &ndash; non-coding regions) that can occur in multiple contexts in the microbial community under study. It uses Vmatch [2] to extend seed reads (or contigs generated by another assembler) into longer contigs, by iteratively calling Vmatch and Trinity, until some stop criteria are met. Currently, TriMetAss lacks a thorough documentation, but you can direct questions to me if the README.txt file and the &ldquo;-h&rdquo; option is not sufficient to understand the software.<br /><br /></li>
</ul>
</li>
<li><a href="https://github.com/sharpa/OMWare" title="OMWare 1.0 &ndash; Efficient Assembly of Genome-wide Physical Maps">OMWare 1.0 &ndash; Efficient Assembly of Genome-wide Physical Maps</a>
<ul>
<li>
<p>The purpose of this Python module is help scientists use optical map data.<br />Once complete, it will encapsulate and abstractify optical maps and their most common manipulations as they exist in a variety of formats.</p>
</li>
</ul>
</li>
<li><a href="https://github.com/SaraEl-Metwally/LightAssembler" title="LightAssembler &ndash; Lightweight Resources Assembly Algorithm">LightAssembler &ndash; Lightweight Resources Assembly Algorithm</a>
<ul>
<li>
<p>Lightweight resources assembly algorithm for high-throughput sequencing reads.<br />System requirements<br />64-bit machine with g++ compiler or gcc in general, pthreads,and zlib libraries.</p>
</li>
</ul>
</li>
<li><a href="http://bioinf.spbau.ru/quast" title="QUAST 4.1 &ndash; Quality Assessment Tool for Genome Assemblies">QUAST 4.1 &ndash; Quality Assessment Tool for Genome Assemblies</a>
<ul>
<li>
<p>QUAST evaluates genome assemblies.<br />QUAST works both with and without a reference genome.&nbsp;<br />The tool accepts multiple assemblies, thus is suitable for comparison.</p>
</li>
</ul>
</li>
<li><a href="http://www.dnabaser.com/index.html" title="DNA Baser 4.36 &ndash; DNA Sequence Assembly &amp; Analysis">DNA Baser 4.36 &ndash; DNA Sequence Assembly &amp; Analysis</a>
<ul>
<li>DNA Sequence Assembler is revolutionary bioinformatics software for automatic DNA sequence assembly , DNA sequence analysis, contig editing, file format conversion and mutation detection.<br /><br /></li>
</ul>
</li>
<li><a href="https://github.com/younglululu/COCACOLA" title="COCACOLA &ndash; Binning Metagenomic Contigs using Sequence COmposition, Read CoverAge, CO-alignment, and Paired-end Read LinkAge">COCACOLA &ndash; Binning Metagenomic Contigs using Sequence COmposition, Read CoverAge, CO-alignment, and Paired-end Read LinkAge<br /></a>
<ul>
<li>COCACOLA: a general framework for binning contigs in metagenomic studies incorporating read COverage, CorrelAtion, sequence COmposition and paired-end read LinkAge<br /><br /></li>
</ul>
</li>
<li><a href="http://downloads.jbei.org/data/microbial_communities/MaxBin/MaxBin.html" title="MaxBin 2.2 &ndash; Binning Assembled Metagenomic Sequences">MaxBin 2.2 &ndash; Binning Assembled Metagenomic Sequences</a>
<ul>
<li>MaxBin is software for binning assembled metagenomic sequences based on an Expectation-Maximization algorithm. Users can understand the underlying bins (genomes) of the microbes in their metagenomes by simply providing assembled metagenomic sequences and the reads coverage information or sequencing reads.&nbsp;<br /><br /></li>
</ul>
</li>
<li><a href="http://compbio.fmph.uniba.sk/gaml/" title="GAML 0.1 &ndash; Genome Assembly by Maximum Likelihood">GAML 0.1 &ndash; Genome Assembly by Maximum Likelihood<br /></a>
<ul>
<li>GAML is a prototype genome assembly tool based on maximizing likelihood of the assembly in a model encompaasing error rate, insert length and other features of indvidual sequencing technologies. It can combine datasets produced by different technologies (currently Illumina, 454 and Pacific Biosciences).<br /><br /></li>
</ul>
</li>
<li><a href="https://github.com/kkrizanovic/NanoMark" title="NanoMark &ndash; DNA Assembly Benchmark for Nanopore long reads">NanoMark &ndash; DNA Assembly Benchmark for Nanopore long reads</a>
<ul>
<li>
<p>DNA Assembly Benchmark for Nanopore long reads<br />A system for benchmarking DNA assembly tools, based on 3rd generation sequencers.</p>
</li>
</ul>
</li>
<li><a href="http://ibest.github.io/ARC/" title="ARC 1.1.4-beta &ndash; Assembly by Reduced Complexity">ARC 1.1.4-beta &ndash; Assembly by Reduced Complexity</a>
<ul>
<li>
<p>ARC is a pipeline which facilitates iterative, reference guided de novo assemblies with the intent of:&nbsp;<br />1.Reducing time in analysis and increasing accuracy of results by only considering those reads which should assemble together.<br />2.Reducing/removing reference bias as compared to mapping based approaches.</p>
</li>
</ul>
</li>
<li><a href="https://bioinformatics.cs.vt.edu/zhanglab/software/transps/" title="TransPS 1.1.0 &ndash; Transcriptome Post Scaffolding">TransPS 1.1.0 &ndash; Transcriptome Post Scaffolding</a>
<ul>
<li>TransPS is a pipeline for post-processing of pre-assembled transcriptomes using reference based method. It applies an align-layout-consensus structure, consisting of three major stages. First, query sequences are aligned with a reference genome. Second, query sequences are ordered based on the alignment to the reference. Third, non-redundant sequences matched to the same gene of reference genome are scaffolded into one contig.&nbsp;<br /><br /></li>
</ul>
</li>
<li><a href="http://andersonlab.qb3.berkeley.edu/#/software" title="assemblyManager &ndash; Computing the Robotic Commands for 2ab Assembly">assemblyManager &ndash; Computing the Robotic Commands for 2ab Assembly</a>
<ul>
<li>Clotho provides persistence to such objects through relational databases that at least partially correspond the Clotho data model. Beyond database access and data model API support, Clotho Apps provide more specific functionality to Clotho such as viewing and editing data, running simulations, and automating various tasks. When thinking about Clotho Apps, an appropriate analogy would be Apps running on the Android operating system rather than the add-ons that extend the functionality of Firefox<br /><br /></li>
</ul>
</li>
<li><a href="https://sourceforge.net/projects/transcriptomeassembly/" title="BinPacker 1.1 &ndash; Packing-Based De Novo Transcriptome Assembly from RNA-seq Data">BinPacker 1.1 &ndash; Packing-Based De Novo Transcriptome Assembly from RNA-seq Data</a>
<ul>
<li>BinPacker is a novel de novo assembler by modeling the transcriptome assembly problem as tracking a set of trajectories of items with their sizes representing coverage of their corresponding isoforms by solving a series of bin-packing problems<br /><br /></li>
</ul>
</li>
<li><a href="https://github.com/lh3/fermikit" title="FermiKit 0.13 &ndash; De novo Assembly based Variant Calling pipeline for Illumina Short Reads">FermiKit 0.13 &ndash; De novo Assembly based Variant Calling pipeline for Illumina Short Reads</a>
<ul>
<li>FermiKit is a&nbsp;<em>de novo</em>&nbsp;assembly based variant calling pipeline for deep Illumina resequencing data. It assembles reads into unitigs, maps them to the reference genome and then calls variants from the alignment to an accuracy comparable to conventional mapping based pipelines (see evaluation in the&nbsp;<code>tex</code>&nbsp;directory). The assembly does not only encode SNPs and short INDELs, but also retains long deletions, novel sequence insertions, translocations and copy numbers<br /><br /></li>
</ul>
</li>
<li><a href="https://github.com/Reedwarbler/REPdenovo" title="REPdenovo &ndash; A tool to Construct Repeats directly from Raw Reads">REPdenovo &ndash; A tool to Construct Repeats directly from Raw Reads</a>
<ul>
<li>
<p>REPdenovo is designed for constructing repeats directly from sequence reads. It based on the idea of frequent k-mer assembly. REPdenovo provides many functionalities, and can generate much longer repeats than existing tools. The overall pipeline is shown in the mannual file. REPdenovo supports the following main functionalities.<br />1.Assembly. This step performs k-mer counting. Then we find frequent k-mers whose frequencies are over certain threshold. We then assemble these frequent k-mers into consensus repeats (in the form of contigs). Then we merge the constructed contigs to more completeness ones.<br />2.Scaffolding. We use paired-end reads to connect repeat contigs into scaffolds, also provide the average coverage (indicates the copy number) for each constructed repeats.</p>
</li>
</ul>
</li>
<li><a href="https://github.com/rdpstaff/Xander_assembler" title="Xander &ndash; Gene-targeted Metagenomic Assembler">Xander &ndash; Gene-targeted Metagenomic Assembler</a>
<ul>
<li>Metagenomics can provide important insight into microbial communities. However, assembling metagenomic datasets has proven to be computationally challenging. We present a novel method for targeting assembly of specific protein-coding genes using a graph structure combining both de Bruijn graphs and protein HMMs. The inclusion of HMM information guides the assembly, with concomitant gene annotation.&nbsp;<br /><br /></li>
</ul>
</li>
<li><a href="https://sourceforge.net/projects/swapassembler/" title="SWAP-Assembler 2 &ndash; A scalable and fully parallelized Genome Assembler">SWAP-Assembler 2 &ndash; A scalable and fully parallelized Genome Assembler</a>
<ul>
<li>There is a growing gap between the output of new generation massively parallel sequencing machines and the ability to process and analyze the sequencing data. We present SWAP-Assembler, a scalable and fully parallelized genome assembler designed for massive sequencing data. Intend of using traditional de Bruijn Graph, SWAP-Assembler adopts multi-step bi-directed graph (MSG). With MSG, the standard genome assembly (SGA) is equivalent to the edge merging operations in a semi-group. Then a computation model, SWAP, is designed to parallelize semi-group computation. Experimental results showed that SWAP-Assembler is the fastest and most efficient assemblers ever, it can generated contigs with highest accuracy over all five selected assemblers and longest contig N50 in all selected parallel assemblers. Specially, in the scalability test, SWAP-Assembler can scales up to 1024 cores when processing Fish and Yanhuang dataset, and finishes the assembly work in only 15 and 29 minutes respecitively<br /><br /></li>
</ul>
</li>
<li><a href="https://github.com/ksanao/TGNet" title="TGNet &ndash; Visualization and Quality Assessment of de novo Genome Assemblies">TGNet &ndash; Visualization and Quality Assessment of de novo Genome Assemblies</a>
<ul>
<li>TGNet is a Cytoscape-based tool for visualization and quality assessment of de novo genome assemblies. Specifically it facilitates rapid detection of inconsistencies between a genome assembly and an independently derived transcriptome assembly.<br /><br /></li>
</ul>
</li>
<li><a href="http://sanger-pathogens.github.io/circlator/" title="Circlator 1.1.3 &ndash; A tool to Circularize Genome Assemblies">Circlator 1.1.3 &ndash; A tool to Circularize Genome Assemblies</a>
<ul>
<li>A tool to circularize genome assemblies. The algorithm and benchmarks are described in the&nbsp;<a href="http://www.genomebiology.com/2015/16/1/294">Genome Biology manuscript</a>.&nbsp;<br /><br /></li>
</ul>
</li>
<li><a href="https://github.com/hitbio/misFinder" title="misFinder v0.4.05.05 &ndash; Identify Mis-assemblies in an unbiased manner using Reference and Paired-end Reads">misFinder v0.4.05.05 &ndash; Identify Mis-assemblies in an unbiased manner using Reference and Paired-end Reads</a>
<ul>
<li>misFinder is a tool that aims to identify the assembly errors with high accuracy in an unbiased way and correct these errors at their mis-assembled positions to improve the assembly accuracy for downstream analysis. It combines the information of reference (or close related reference) genome and aligned paired-end reads to the assembled sequence. Structure variation and mis-assembly can be detected by comparing the reference genome and assembled sequence.<br /><br /></li>
</ul>
</li>
<li><a href="http://edwards.sdsu.edu/scaffold_builder/" title="Scaffold_builder v2.2 &ndash; Order Contigs generated by draft sequencing along a Reference Sequence">Scaffold_builder v2.2 &ndash; Order Contigs generated by draft sequencing along a Reference Sequence</a>
<ul>
<li>The abundance of repeat elements in genomes can impede the assembly of a single sequence. The tool Scaffold_builder was designed to generate scaffolds (super contigs of sequences joined by N-bases) using the homology provided by a closely related reference sequence. Scaffold_builder is an advanced wrapper for Nucmer, written in Python that resolves several situations that may arise when mapping contigs to the reference genome.<br /><br /></li>
</ul>
</li>
<li><a href="https://sites.google.com/a/lbl.gov/rnnotator/" title="Rnnotator 3.5.0 &ndash; de novo Transcriptome Assembly pipeline from stranded RNA-Seq reads">Rnnotator 3.5.0 &ndash; de novo Transcriptome Assembly pipeline from stranded RNA-Seq reads</a>
<ul>
<li>Comprehensive annotation and quantification of transcriptomes are outstanding problems in functional genomics. Rnnotator is an automated software pipeline that generates transcript models by de novo assembly of RNA-Seq data without the need for a reference genome. The contigs produced by Rnnotator are highly accurate and reconstruct full-length genes when transcripts are sequenced sufficiently deep, roughly 30X for a given transcript. Rnnotator was designed to assemble Illumina single or paired-end reads. Rnnotator is also able to incorporate strand-specific RNA-Seq reads into the assembly in order to further improve the assembly.<br /><br /></li>
</ul>
</li>
<li><a href="http://satrap.cribi.unipd.it/cgi-bin/satrap.pl" title="SATRAP 0.2 &ndash; SOLiD Assembler TRAnslation Program">SATRAP 0.2 &ndash; SOLiD Assembler TRAnslation Program</a>
<ul>
<li>
<p>A color space assembly must be translated into bases before applying bioinformatics analyses. SATRAP is designed to accomplish this important task adopting a very efficient strategy. The package integrates the Oases pipeline and several optimizations specifically designed for color space management. All steps of the pipeline allow to produce a SOLiD de novo transcriptome assembly and the subsequent color space translation. Alternatively, SATRAP can be used as a stand alone program to perform color space translation for either RNA-seq or DNA-seq SOLiD assemblies.</p>
</li>
</ul>
</li>
<li><a href="http://rrwick.github.io/Bandage/" title="Bandage v0.7.1 &ndash; Navigating De novo Assembly Graphs Easily">Bandage v0.7.1 &ndash; Navigating De novo Assembly Graphs Easily</a>
<ul>
<li>Bandage is a program for visualising de novo assembly graphs. By displaying connections which are not present in the contigs file, Bandage opens up new possibilities for analysing de novo assemblies.<br /><br /></li>
</ul>
</li>
<li><a href="http://hapcol.algolab.eu/" title="HapCol 1.1.1 &ndash; Haplotype Assembly from Long Gapless Reads">HapCol 1.1.1 &ndash; Haplotype Assembly from Long Gapless Reads</a>
<ul>
<li>A fast and memory-efficient method for haplotype assembly from long gapless reads, like those produced by SMRT sequencing technologies (PacBio RS II) and Oxford Nanopore flow cell technologies (MinION).<br /><br /></li>
</ul>
</li>
<li><a href="https://github.com/chengyuan/reago-1.1" title="REAGO 1.1 &ndash; REconstruct 16S ribosomal RNA Genes from MetagenOmic data">REAGO 1.1 &ndash; REconstruct 16S ribosomal RNA Genes from MetagenOmic data<br /></a>
<ul>
<li>an assembly tool for 16S ribosomal RNA recovery from metagenomic data<br /><br /></li>
</ul>
</li>
<li><a href="http://www.bioinfo.ufpr.br/" title="FGAP 1.8.1 &ndash; Automated Gap Closing tool">FGAP 1.8.1 &ndash; Automated Gap Closing tool</a>
<ul>
<li>FGAP aims to improve genome sequences by merging alternative assemblies or incorporating alternative data, analyzing the gap region and indicating the best sequence to close the gap.<br /><br /></li>
</ul>
</li>
<li><a href="http://deweylab.biostat.wisc.edu/detonate/" title="DETONATE 1.10 &ndash; DE novo TranscriptOme rNa-seq Assembly with or without the Truth Evaluation">DETONATE 1.10 &ndash; DE novo TranscriptOme rNa-seq Assembly with or without the Truth Evaluation</a>
<ul>
<li>DETONATE consists of two component packages, RSEM-EVAL and REF-EVAL. Both packages are mainly intended to be used to evaluate de novo transcriptome assemblies, although REF-EVAL can be used to compare sets of any kinds of genomic sequences.<br /><br /></li>
</ul>
</li>
<li><a href="https://github.com/trinityrnaseq/trinityrnaseq/wiki" title="Trinity 2.1.1 &ndash; RNA-Seq De novo Assembly">Trinity 2.1.1 &ndash; RNA-Seq De novo Assembly<br /></a>
<ul>
<li>Trinity represents a novel method for the efficient and robust de novo reconstruction of transcriptomes from RNA-Seq data. Trinity combines three independent software modules: Inchworm, Chrysalis, and Butterfly, applied sequentially to process large volumes of RNA-Seq reads. Trinity partitions the sequence data into many individual de Bruijn graphs, each representing the transcriptional complexity at at a given gene or locus, and then processes each graph independently to extract full-length splicing isoforms and to tease apart transcripts derived from paralogous genes.<br /><br /></li>
</ul>
</li>
<li><a href="https://github.com/shenkers/isoscm" title="IsoSCM 2.0.11 &ndash; Transcript Assembly tool using Multiple Change-point Inference to improve 3&rsquo;UTR Annotation">IsoSCM 2.0.11 &ndash; Transcript Assembly tool using Multiple Change-point Inference to improve 3&rsquo;UTR Annotation</a>
<ul>
<li>IsoSCM (Isoform Structural Change Model) is a new method for transcript assembly &nbsp;that incorporates change-point analysis to improve the 3&prime; UTR annotation process.<br /><br /></li>
</ul>
</li>
<li><a href="http://sanger-pathogens.github.io/iva/" title="IVA 1.0.3 &ndash; Iterative Virus Assembler">IVA 1.0.3 &ndash; Iterative Virus Assembler</a>
<ul>
<li>IVA is a de novo assembler designed to assemble virus genomes that have no repeat sequences, using Illumina read pairs sequenced from mixed populations at extremely high and variable depth.<br /><br /></li>
</ul>
</li>
<li><a href="https://sourceforge.net/projects/spa-assembler/" title="SFA-SPA 0.2.1 &ndash; A Suffix Array based Short Peptide Assembler for Metagenomic Data">SFA-SPA 0.2.1 &ndash; A Suffix Array based Short Peptide Assembler for Metagenomic Data</a>
<ul>
<li>SFA-SPA is a suffix array based short peptide assembler for metagenomic data<br /><br /></li>
</ul>
</li>
<li><a href="http://www.earlham.ac.uk/rampart/" title="RAMPART 0.12.2 &ndash; A Workflow Management System for de novo Genome Assembly">RAMPART 0.12.2 &ndash; A Workflow Management System for de novo Genome Assembly</a>
<ul>
<li>RAMPART is a de novo assembly pipeline that makes use of third party-tools and High Performance Computing resources. It can be used as a single interface to several popular assemblers, and can perform automated comparison and analysis of any generated assemblies<br /><br /></li>
</ul>
</li>
<li><a href="http://wgs-assembler.sourceforge.net/wiki/index.php?title=Main_Page" title="Celera Assembler 8.3 &ndash; Whole Genome Shotgun Assembler">Celera Assembler 8.3 &ndash; Whole Genome Shotgun Assembler</a>
<ul>
<li>Celera Assembler (wgs-assembler) is scientific software for DNA research. It can reconstruct long sequences of genomic DNA given the fragmentary data produced by whole-genome shotgun sequencing. The Celera Assembler has enabled discovery in microbial genomes, large eukaryotic genomes, diploid genomes, and genomes from environmental samples. Celera Assembler contributed the first diploid sequence of an individual human, and metagenomics assemblies of the Global Ocean Sampling<br /><br /></li>
</ul>
</li>
<li><a href="https://sourceforge.net/projects/ngopt/" title="A5-miseq 20150522 &ndash; de novo Assembly &amp; Analysis of Illumina Sequence data">A5-miseq 20150522 &ndash; de novo Assembly &amp; Analysis of Illumina Sequence data</a>
<ul>
<li>de novo assembly &amp; analysis of Illumina sequence data, including the A5 pipeline, A5-miseq, tools to evaluate assembly quality, and scripts to facilitate data submission to NCBI and the RAST annotation system<br /><br /></li>
</ul>
</li>
<li><a href="http://www.bcgsc.ca/platform/bioinfo/software/trans-abyss" title="Trans-ABySS 1.5.3 &ndash; Analyze ABySS multi-k-assembled Shotgun Transcriptome Data.">Trans-ABySS 1.5.3 &ndash; Analyze ABySS multi-k-assembled Shotgun Transcriptome Data.</a>
<ul>
<li>Trans-ABySS is a software pipeline for analyzing ABySS-assembled contigs from shotgun transcriptome data. The pipeline accepts assemblies that were generated across a wide range of k values in order to address variable transcript expression levels. It first filters and merges the multi-k assemblies, generating a much smaller set of nonredundant contigs. It contains scripts that map assembled contigs to known transcripts, currently supporting Blat and Exonerate contig-to-genome aligners. It identifies novel splicing events like exon-skipping, novel exons, retained introns, novel introns, and alternative splicing. Its scripts can also estimate gene expression levels, identify candidate polyadenylation sites, and identify candidate gene-fusion events.<br /><br /></li>
</ul>
</li>
<li><a href="https://sourceforge.net/projects/sat-assembler/" title="SAT-Assembler 20160120 &ndash; Scalable and Accurate Targeted Gene Assembly Tool">SAT-Assembler 20160120 &ndash; Scalable and Accurate Targeted Gene Assembly Tool</a>
<ul>
<li>SAT-Assembler can perform targeted gene assembly for both RNA-Seq and metagenomic data. It addresses the above challenges of de novo assembly of large scale NGS data by conducting family-specic gene assembly, homology-guided overlap graph construction, and careful graph traversal.<br /><br /></li>
</ul>
</li>
<li><a href="https://sourceforge.net/projects/operasf/" title="Opera 2.0.2 &ndash; Sequence Assembly Program">Opera 2.0.2 &ndash; Sequence Assembly Program</a>
<ul>
<li>Opera (Optimal Paired-End Read Assembler) is a sequence assembly program . It uses information from paired-end reads to optimally order and orient contigs assembled from shotgun-sequencing reads.<br /><br /></li>
</ul>
</li>
<li><a href="http://www.genecodes.com/" title="Sequencher 5.4.1 &ndash; DNA Sequence Assembly and Analysis">Sequencher 5.4.1 &ndash; DNA Sequence Assembly and Analysis</a>
<ul>
<li>Sequencher is the industry standard software for DNA sequence analysis. It works with all automated sequencers and is widely known for its lightning-fast contig assembly, short learning curve, user-friendly editing tools, and superb technical support. First released almost 15 years ago, Sequencher is currently used for sequence analysis tasks in every major genomic and pharmaceutical company as well as numerous academic and government labs in over 40 countries around the world. Life Science researchers use Sequencher for many diverse DNA sequence analysis applications including de novo gene sequencing, mutation detection, forensic human identification, systematics, and more.<br /><br /></li>
</ul>
</li>
<li><a href="http://minia.genouest.org/" title="Minia 2.0.3 &ndash; Short-read Assembler based on a de Bruijn graph">Minia 2.0.3 &ndash; Short-read Assembler based on a de Bruijn graph</a>
<ul>
<li>Minia is a short-read assembler based on a de Bruijn graph, capable of assembling a human genome on a desktop computer in a day<br /><br /></li>
</ul>
</li>
<li><a href="http://www.genome.umd.edu/masurca.html" title="MaSuRCA 3.1.3 &ndash; Whole Genome Short Read Assembler">MaSuRCA 3.1.3 &ndash; Whole Genome Short Read Assembler</a>
<ul>
<li>MaSuRCA is whole genome assembly software. It combines the efficiency of the de Bruijn graph and Overlap-Layout-Consensus (OLC) approaches. MaSuRCA can assemble data sets containing only short reads from Illumina sequencing or a mixture of short reads and long reads (Sanger, 454).<br /><br /></li>
</ul>
</li>
<li><a href="http://kmergenie.bx.psu.edu/" title="KmerGenie 1.6982 &ndash; K-mer size Selection for Genome Assembly">KmerGenie 1.6982 &ndash; K-mer size Selection for Genome Assembly</a>
<ul>
<li>KmerGenie estimates the best k-mer length for genome de novo assembly. Given a set of reads, KmerGenie first computes the k-mer abundance histogram for many values of k. Then, for each value of k, it predicts the number of distinct genomic k-mers in the dataset, and returns the k-mer length which maximizes this number. Experiments show that KmerGenie&rsquo;s choices lead to assemblies that are close to the best possible over all k-mer lengths.<br /><br /></li>
</ul>
</li>
<li><a href="http://software.broadinstitute.org/software/pilon/" title="pilon v1.16 &ndash; Automated Assembly Improvement">pilon v1.16 &ndash; Automated Assembly Improvement</a>
<ul>
<li>pilon uses read alignment analysis to diagnose, report, and automatically improve de novo genome assemblies.<br /><br /></li>
</ul>
</li>
<li><a href="http://www.phrap.org/phredphrapconsed.html#block_phrap" title="Phred/Phrap/Consed 29.0 &ndash; DNA Sequence Assembler &amp; Finishing Tools">Phred/Phrap/Consed 29.0 &ndash; DNA Sequence Assembler &amp; Finishing Tools<br /></a>
<ul>
<li>phrap is a program for assembling shotgun DNA sequence data. Among other features, it allows use of the entire read and not just the trimmed high quality part, it uses a combination of user-supplied and internally computed data quality information to improve assembly accuracy in the presence of repeats, it constructs the contig sequence as a mosaic of the highest quality read segments rather than a consensus, it provides extensive assembly information to assist in trouble-shooting assembly problems, and it handles large datasets.<br /><br /></li>
</ul>
</li>
<li><a href="https://www.qiagenbioinformatics.com/products/clc-genomics-workbench/" title="CLC Genomics Workbench 8.5.1 &ndash; Assembly &amp; Analysis of Sequencing Data">CLC Genomics Workbench 8.5.1 &ndash; Assembly &amp; Analysis of Sequencing Data</a>
<ul>
<li>CLC Genomics Workbench, for analyzing and visualizing Next Generation Sequencing data, incorporates cutting-edge technology and algorithms, while also supporting and integrating with the rest of your typical NGS workflow.<br /><br /></li>
</ul>
</li>
<li><a href="http://schatzlab.cshl.edu/research/metassembler/" title="Metassembler 1.5 &ndash; Combines multiple Whole Genome de novo Assemblies into a combined Consensus Assembly">Metassembler 1.5 &ndash; Combines multiple Whole Genome de novo Assemblies into a combined Consensus Assembly</a>
<ul>
<li>Metassembler is a software package for reconciling assemblies produced by de novo short-read assemblers such as SOAPdenovo and ALLPATHS-LG. The goal of assembly reconciliation, or &ldquo;metassembly,&rdquo; is to combine multiple assemblies into a single genome that is superior to all of its constituents<br /><br /></li>
</ul>
</li>
<li><a href="https://ics.hutton.ac.uk/tablet/" title="Tablet 1.15.09.01 &ndash; Next Generation Sequence Assembly Visualization">Tablet 1.15.09.01 &ndash; Next Generation Sequence Assembly Visualization</a>
<ul>
<li>Tablet is a lightweight, high-performance graphical viewer for next generation sequence assemblies and alignments.Supporting a range of input assembly formats, Tablet provides high-quality visualizations showing data in packed or stacked views, allowing instant access and navigation to any region of interest, and whole contig overviews and data summaries. Tablet is both multi-core aware and memory efficient, allowing it to handle assemblies containing millions of reads, even on a 32-bit desktop machine.<br /><br /></li>
</ul>
</li>
<li><a href="http://www.bcgsc.ca/platform/bioinfo/software/abyss" title="ABySS 1.9.0 &ndash; de novo, parallel, paired-end Sequence Assembler">ABySS 1.9.0 &ndash; de novo, parallel, paired-end Sequence Assembler</a>
<ul>
<li>ABySS (Assembly By Short Sequences) is a de novo, parallel, paired-end sequence assembler that is designed for short reads. The single-processor version is useful for assembling genomes up to 100 Mbases in size. The parallel version is implemented using MPI and is capable of assembling larger genomes.<br /><br /></li>
</ul>
</li>
<li><a href="http://www.bcgsc.ca/platform/bioinfo/software/cleat" title="CLEAT 2.0 &ndash; Identifies 3&prime; UTR Ends of Transcripts in de novo RNA-Seq Assemblies">CLEAT 2.0 &ndash; Identifies 3&prime; UTR Ends of Transcripts in de novo RNA-Seq Assemblies</a>
<ul>
<li>CLEAT is a post-processing tool for CLEavage site Analysis of Transcriptomes. CLEAT is designed to work on trans-ABySS output.<br /><br /></li>
</ul>
</li>
<li><a href="https://github.com/ythuang0522/StriDe" title="StriDe &ndash; novel Assembler">StriDe &ndash; novel Assembler</a>
<ul>
<li>The StriDe Assembler integrates string and de Bruijn graph by decomposing reads within error-prone regions, while extending paire-end read into long reads for assembly through repetitive regions.<br /><br /></li>
</ul>
</li>
<li><a href="http://www.sanger.ac.uk/science/tools/reapr" title="REAPR 1.0.18 &ndash; Genome Assembly Evaluation">REAPR 1.0.18 &ndash; Genome Assembly Evaluation</a>
<ul>
<li>REAPR (Recognising Errors in Assemblies using Paired Reads) is a tool that evaluates the accuracy of a genome assembly using mapped paired end reads, without the use of a reference genome for comparison. It can be used in any stage of an assembly pipeline to automatically break incorrect scaffolds and flag other errors in an assembly for manual inspection. It reports mis-assemblies and other warnings, and produces a new broken assembly based on the error calls.<br /><br /></li>
</ul>
</li>
<li><a href="https://www.baseclear.com/genomics/bioinformatics/basetools/gapfiller" title="GapFiller 1.10 &ndash; Close Gaps within Pre-assembled Scaffolds">GapFiller 1.10 &ndash; Close Gaps within Pre-assembled Scaffolds</a>
<ul>
<li>GapFiller is a stand-alone program for closing gaps within pre-assembled scaffolds. It is unique in offering the possibility to manually control the gapclosure process. By using the distance information of paired-read data, GapFiller seeks to close the gap from each edge in an iterative manner. From a good number of tests we see the program yields excellent results both on bacterial en eukaryotic &nbsp;datasets. The command-line Perl script and additional files van be downloaded below. The input data is given by pre-assembled scaffold sequences (FASTA) and NGS paired-read data (FASTA or FASTQ).<br /><br /></li>
</ul>
</li>
<li><a href="http://www.bcgsc.ca/platform/bioinfo/software/ssake" title="SSAKE 3.8.4 &ndash; Assembling Millions of short DNA Sequences">SSAKE 3.8.4 &ndash; Assembling Millions of short DNA Sequences</a>
<ul>
<li>SSAKE is a genomics application for assembling millions of very short DNA sequences.SSAKE is designed to help leverage the information from short sequence reads by stringently assembling them into contiguous sequences that can be used to characterize novel sequencing targets.<br /><br /></li>
</ul>
</li>
<li><a href="https://github.com/jts/sga" title="SGA 0.10.14 &ndash; String Graph Assembler">SGA 0.10.14 &ndash; String Graph Assembler</a>
<ul>
<li>SGA is a de novo assembler designed to assemble large genomes from high coverage short read data. The major goal of SGA is to be very memory efficient, which is achieved by using a compressed representation of DNA sequence reads.<br /><br /></li>
</ul>
</li>
<li><a href="https://bibiserv.cebitec.uni-bielefeld.de/cgcat" title="r2cat &ndash; Synteny Plots &amp; Comparative Assembly">r2cat &ndash; Synteny Plots &amp; Comparative Assembly<br /></a>
<ul>
<li>r2cat (related reference based contig arrangement tool) can be used to order a set of contigs with respect to a single reference genome. This is done by mapping the contigs onto the reference using a q-gram filter. The mapping is visualized in a synteny plot.<br /><br /></li>
</ul>
</li>
<li><a href="http://www.bcgsc.ca/platform/bioinfo/software/tasr" title="TASR 1.6 &ndash; Targeted Assembly of Sequence Reads">TASR 1.6 &ndash; Targeted Assembly of Sequence Reads</a>
<ul>
<li>TASR (Targeted Assembly of Sequence Reads) &nbsp;is a genomics application that allows hypothesis-based interrogation of genomic regions (sequence targets) of interest.<br /><br /></li>
</ul>
</li>
<li><a href="https://sourceforge.net/projects/bio-rainbow/" title="Rainbow v2.0.4 &ndash; Clustering and Assembling Short Reads, especially for RAD">Rainbow v2.0.4 &ndash; Clustering and Assembling Short Reads, especially for RAD</a>
<ul>
<li>Rainbow package consists of several programs used for RAD-seq related clustering and de novo assembly.<br /><br /></li>
</ul>
</li>
<li><a href="http://www.sanger.ac.uk/science/tools/caf" title="CAFTOOLS 2.0.2 &ndash; Tools for the Common Assembly Format (CAF)">CAFTOOLS 2.0.2 &ndash; Tools for the Common Assembly Format (CAF)</a>
<ul>
<li>CAFTOOLS comprises a set of libraries and programs for manipulating DNA sequence assemblies using CAF files, a comprehensive representation of a sequence assembly as a text file.</li>
</ul>
</li>
<li>Gap Resolution &ndash; Improving Newbler Genome Assemblies. Gap Resolution was developed by DOE Joint Genome Institute to improve Newbler genome assemblies by automating the closure of sequence gaps caused by repetitive regions in the DNA.<br /><br /></li>
<li><a href="http://jgi.doe.gov/data-and-tools/meraculous/" title="Meraculous 2.0.5 &ndash; De novo Genome Assembler from Short Reads">Meraculous 2.0.5 &ndash; De novo Genome Assembler from Short Reads</a>
<ul>
<li>Meraculous is a new algorithm for whole genome assembly of deep paired-end short reads, and apply it to the assembly of a dataset of paired 75-bp Illumina reads derived from the 15.4 megabase genome of the haploid yeast Pichia stipitis.<br /><br /></li>
</ul>
</li>
<li><a href="https://sourceforge.net/projects/coperead/" title="COPE 1.2.5 &ndash; Pair-end Reads Connection tool to facilitate Genome Assembly">COPE 1.2.5 &ndash; Pair-end Reads Connection tool to facilitate Genome Assembly</a>
<ul>
<li>COPE (Connecting Overlapped Pair-End reads) is a method to align and connect the illumina sequenced Pair-End reads of which the insert size is smaller than the sum of the two read length.The connected reads can be used in genome assembly, resequencing and transcriptome research.<br /><br /></li>
</ul>
</li>
<li><a href="http://sco.h-its.org/exelixis/web/software/pear/index.html" title="PEAR 0.9.6 &ndash; Pair-End reads AssembleR">PEAR 0.9.6 &ndash; Pair-End reads AssembleR</a>
<ul>
<li>PEAR is an ultrafast, memory-efficient and highly accurate pair-end reads assembler. It is fully parallelized and can run with as low as just a few kilobytes of memory.<br /><br /></li>
</ul>
</li>
<li><a href="https://sourceforge.net/projects/ebardenovo/" title="EBARDenovo 2.0.1 &ndash; Highly-accurate de novo Assembler of Paired-end RNA-Seq">EBARDenovo 2.0.1 &ndash; Highly-accurate de novo Assembler of Paired-end RNA-Seq</a>
<ul>
<li>EBARDenovo is a highly-accurate search-based de novo assembler of paired-end RNA-Seq for advance transcriptomic study.<br /><br /></li>
</ul>
</li>
<li><a href="http://marthlab.org/" title="EagleView 2.2 &ndash; Genome Assembler Viewer">EagleView 2.2 &ndash; Genome Assembler Viewer</a>
<ul>
<li>EagleView is an information-rich genome assembler viewer with data integration capability. EagleView can display a dozen different types of information including base qualities, machine specific trace signals, and genome feature annotations. It provides an easy way for inspecting visually the quality of a genome assembly and validating polymorphism candidate sites (e.g., SNPs) reported by polymorphism discovery tools. It can also facilitate data interpretation and hypothesis generation.<br /><br /></li>
</ul>
</li>
<li><a href="http://bioinformatics.tudelft.nl/" title="MAIA 0.5 &ndash; Integrating Genome Assemblies">MAIA 0.5 &ndash; Integrating Genome Assemblies</a>
<ul>
<li>
<p>MAIA (Multiple Assembly IntegrAtion) is an algorithm to integrate multiple genome assemblies. For example, assemblies originating from:<br />&ndash; Different runs of a de novo assembler<br />&ndash; Assemblies of different data types<br />&ndash; Comparative assemblies</p>
</li>
</ul>
</li>
<li><a href="http://cqb.pku.edu.cn/ZhuLab/InteMAP/index.html" title="InteMAP 1.0 &ndash; Integrated Metagenomic Assembly pipeline for NGS Short Reads">InteMAP 1.0 &ndash; Integrated Metagenomic Assembly pipeline for NGS Short Reads<br /></a>
<ul>
<li>InteMAP is a pipeline which integrates individual assemblers for assembling metagenomic short sequencing reads.<br /><br /></li>
</ul>
</li>
<li><a href="http://cqb.pku.edu.cn/ZhuLab/MAP/index.php" title="MAP 20121108 &ndash; A de novo Metagenomic Assembly program for Shotgun DNA reads">MAP 20121108 &ndash; A de novo Metagenomic Assembly program for Shotgun DNA reads</a>
<ul>
<li>MAP (Metagenomic Assembly program) is a de novo assembly approach and its implementation based on an improved Overlap/Layout/Consensus (OLC) strategy incorporated with several special algorithms.MAP uses the mate pair information, resulting in being more applicable to shotgun DNA reads (recommended as &gt; 200 bp) currently widely-used in metagenome projects. Results of extensive tests on simulated data show that MAP can be superior to both Celera and Phrap for typical longer reads by Sanger sequencing, as well as has an evident advantage over Celera, Newbler, and the newest Genovo, for typical shorter reads by 454 sequencing.<br /><br /></li>
</ul>
</li>
<li><a href="http://www.sanger.ac.uk/science/tools/phusion" title="Phusion 2.1c &ndash; Assembly Genome Sequences from Whole Genome Shotgun(WGS) Reads">Phusion 2.1c &ndash; Assembly Genome Sequences from Whole Genome Shotgun(WGS) Reads</a>
<ul>
<li>Phusion is a software package for assembling genome sequences from whole genome shotgun(WGS) reads.<br /><br /></li>
</ul>
</li>
<li><a href="http://www.codoncode.com/aligner/index.htm" title="CodonCode Aligner 6.0.2 &ndash; DNA Sequence Assembly &amp; Alignment">CodonCode Aligner 6.0.2 &ndash; DNA Sequence Assembly &amp; Alignment</a>
<ul>
<li>CodonCode Aligner is a program for sequence assembly, contig editing, and mutation detection, available for Windows and Mac OS X. Aligner is compatible with Phred-Phrap and fully supports sequence quality scores, while offering a familiar, easy-to-learn user interface.<br /><br /></li>
</ul>
</li>
<li><a href="https://sourceforge.net/projects/ceruleanassembler/" title="Cerulean 0.1.1 &ndash; Hybrid Genome Assembler">Cerulean 0.1.1 &ndash; Hybrid Genome Assembler</a>
<ul>
<li>Cerulean is a hybrid assembly using high throughput short and long reads<br /><br /></li>
</ul>
</li>
<li><a href="http://fenderglass.github.io/Ragout/" title="Ragout 1.2 &ndash; Tool for Reference-assisted Assembly">Ragout 1.2 &ndash; Tool for Reference-assisted Assembly</a>
<ul>
<li>Ragout (Reference-Assisted Genome Ordering UTility) is a tool for assisted assembly using multiple references. It takes a short read assembly (a set of contigs), a set of related references and a corresponding phylogenetic tree and then assembles the contigs into scaffolds.<br /><br /></li>
</ul>
</li>
<li><a href="https://zlab.umassmed.edu/~zhuangj/laSV/" title="laSV 1.0.2 &ndash; Local Assembly based Structural Variation Discovery tool">laSV 1.0.2 &ndash; Local Assembly based Structural Variation Discovery tool</a>
<ul>
<li>laSV is a software that employs a local de novo assembly based approach to detect genomic structural variations from whole-genome high-throughput sequencing datasets.<br /><br /></li>
</ul>
</li>
<li><a href="http://bioinf.spbau.ru/en/spades" title="SPAdes 3.6.2 &ndash; Single-cell Genome Assembler">SPAdes 3.6.2 &ndash; Single-cell Genome Assembler</a>
<ul>
<li>SPAdes (St. Petersburg genome assembler) is intended for both standard isolates and single-cell MDA bacteria assemblies.<br /><br /></li>
</ul>
</li>
<li><a href="https://github.com/hitbio/PERGA" title="PERGA 0.5.03.02 &ndash; Paired End Reads Guided Assembler">PERGA 0.5.03.02 &ndash; Paired End Reads Guided Assembler</a>
<ul>
<li>PERGA is a novel sequence reads guided de novo assembly approach which adopts greedy-like prediction strategy for assembling reads to contigs and scaffolds.<br /><br /></li>
</ul>
</li>
<li><a href="https://sourceforge.net/p/telescoper/wiki/Home/" title="Telescoper 0.2 &ndash; De novo Assembly Algorithm">Telescoper 0.2 &ndash; De novo Assembly Algorithm</a>
<ul>
<li>Telescoper is a local assembly algorithm designed for short-reads from NGS platforms such as Illumina. The reads must come from two libraries: one short insert, and one long insert.<br /><br /></li>
</ul>
</li>
<li><a href="http://metacompass.cbcb.umd.edu/" title="MetaCompass 1.0 &ndash; Comparative Assembly of Metagenomic Sequences">MetaCompass 1.0 &ndash; Comparative Assembly of Metagenomic Sequences</a>
<ul>
<li>MetaCompass is a software package for comparative assembly of metagenomic reads. MetaCompass achieves comparable assembly performance to the state of the art de novo assemblers, but these two different approaches complement each other a lot. So combining contigs between MetaCompass and other independent de novo assemblers give us the best overall metagenomic assembly.<br /><br /></li>
</ul>
</li>
<li><a href="http://evopipes.net/docs.html#scarf_section" title="SCARF &ndash; Scaffolded and Corrected Assembly of Roche 454">SCARF &ndash; Scaffolded and Corrected Assembly of Roche 454</a>
<ul>
<li>SCARF is a next-gen sequence assembly tool for evolutionary genomics. Designed especially for assembling 454 EST sequences against high quality reference sequences from related species.<br /><br /></li>
</ul>
</li>
<li><a href="http://metagenomics.atc.tcs.com/MetaCAA/" title="MetaCAA &ndash; Assembly of Metagenomic Datasets">MetaCAA &ndash; Assembly of Metagenomic Datasets</a>
<ul>
<li>MetaCAA is a sequence-assembly tool specifically intended for metagenomes.<br /><br /></li>
</ul>
</li>
<li><a href="http://mjsull.github.io/Contiguity/" title="Contiguity 1.0.4 &ndash; Contig Adjacency Graph Construction and Visualisation">Contiguity 1.0.4 &ndash; Contig Adjacency Graph Construction and Visualisation</a>
<ul>
<li>Contiguity is interactive software for the visualization and manipulation of de novo genome assemblies.<br /><br /></li>
</ul>
</li>
<li><a href="http://bioresearch.byu.edu/scaffoldscaffolder/" title="ScaffoldScaffolder 0.1 &ndash; Solving Contig Orientation via Bidirected to Directed Graph Reduction">ScaffoldScaffolder 0.1 &ndash; Solving Contig Orientation via Bidirected to Directed Graph Reduction</a>
<ul>
<li>ScaffoldScaffolder is a stand-alone scaffolding algorithm which was designed specifically for scaffolding diploid genomes.<br /><br /></li>
</ul>
</li>
<li><a href="https://github.com/cbg-ethz/haploclique" title="HaploClique 0.1 &ndash; Viral Quasispecies Assembly from Paired-end data">HaploClique 0.1 &ndash; Viral Quasispecies Assembly from Paired-end data</a>
<ul>
<li>HaploClique is a computational approach to reconstruct the structure of a viral quasispecies from next-generation sequencing data as obtained from bulk sequencing of mixed virus samples.<br /><br /></li>
</ul>
</li>
<li><a href="http://omics.informatics.indiana.edu/TAG/" title="TAG 0.91 &ndash; Transcript Assembly by Mapping Reads to Graphs">TAG 0.91 &ndash; Transcript Assembly by Mapping Reads to Graphs</a>
<ul>
<li>TAG is a tool for metatranscriptome assembly using de Bruijn graph of matched metagenome as the reference<br /><br /></li>
</ul>
</li>
<li><a href="https://github.com/bioinfomaticsCSU/EPGA2" title="EPGA2 &ndash; De Novo Assembler">EPGA2 &ndash; De Novo Assembler</a>
<ul>
<li>EPGA2 updates some modules in EPGA which can improve memory efficiency in genome asssembly.<br /><br /></li>
</ul>
</li>
<li><a href="https://sourceforge.net/projects/gmcloser/" title="GMcloser 1.5.1 / GMvalue 1.3 &ndash; Closing the Gaps in Scaffolds with Preassembled Contigs">GMcloser 1.5.1 / GMvalue 1.3 &ndash; Closing the Gaps in Scaffolds with Preassembled Contigs</a>
<ul>
<li>GMcloser fills and closes the gaps present in scaffold assemblies, especially those generated by the de novo assembly of whole genomes with next-generation sequencing (NGS) reads.<br /><br /></li>
</ul>
</li>
<li><a href="https://sites.google.com/a/ucr.edu/slicembler/" title="SLICEMBLER &ndash; Meta-assembler Designed for Ultra-deep Sequencing data">SLICEMBLER &ndash; Meta-assembler Designed for Ultra-deep Sequencing data</a>
<ul>
<li>SLICEMBLER is a meta-assembler designed for ultra-deep sequencing data<br /><br /></li>
</ul>
</li>
<li><a href="http://www.cs.colostate.edu/seq/seqlandscape/" title="SEQLandscape v1 &ndash; Generation and Visualization of Sequence Landscape">SEQLandscape v1 &ndash; Generation and Visualization of Sequence Landscape</a>
<ul>
<li>
<p>SEQLandscape is an application allowing the generation and visualization of a sequence landscape.&nbsp;HyDA-Vista: Towards Optimal Guided Selection of k-mer Size for Sequence Assembly.</p>
</li>
</ul>
</li>
<li><a href="http://www.cs.colostate.edu/seq/missequel/" title="misSEQuel v1.0beta &ndash; Misassembly Detection in Draft Genomes">misSEQuel v1.0beta &ndash; Misassembly Detection in Draft Genomes</a>
<ul>
<li>misSEQuel is a software that enhances the quality of draft genomes by identifying misassembly errors and their breakpoints using paired-end sequence reads and optical mapping data.<br /><br /></li>
</ul>
</li>
<li><a href="http://scit.us/projects/dawg/" title="Dawg 1.2 &ndash; Simulating Sequence Evolution">Dawg 1.2 &ndash; Simulating Sequence Evolution</a>
<ul>
<li>Dawg (DNA Assembly with Gaps) is an application designed to simulate the evolution of recombinant DNA sequences in continuous time based on the robust general time reversible model with gamma and invariant rate heterogeneity and a novel length-dependent model of gap formation.<br /><br /></li>
</ul>
</li>
<li><a href="http://busco.ezlab.org/" title="BUSCO v1.1b1 &ndash; Assessing Genome Assembly and Annotation Completeness with Single-copy Orthologs">BUSCO v1.1b1 &ndash; Assessing Genome Assembly and Annotation Completeness with Single-copy Orthologs</a>
<ul>
<li>BUSCO completeness assessment employs sets of Benchmarking Universal Single-Copy Orthologs from OrthoDB to provide quantitative measures of the completeness of genome assemblies, annotated gene sets, and transcriptomes in terms of expected gene content.<br /><br /></li>
</ul>
</li>
<li><a href="http://kakitone.github.io/finishingTool/" title="FinisherSC 2.0 &ndash; A Repeat-aware tool for upgrading de-novo Assembly using Long Reads">FinisherSC 2.0 &ndash; A Repeat-aware tool for upgrading de-novo Assembly using Long Reads</a>
<ul>
<li>FinisherSC is a repeat-aware and scalable tool for upgrading de-novo assembly using long reads.<br /><br /></li>
</ul>
</li>
<li><a href="https://whatshap.readthedocs.io/en/latest/" title="WhatsHap &ndash; Haplotype Assembly for Future-Generation Sequencing Reads">WhatsHap &ndash; Haplotype Assembly for Future-Generation Sequencing Reads</a>
<ul>
<li>WhatsHap is a software for phasing genomic variants using DNA sequencing reads, also called haplotype assembly. It is especially suitable for long reads, but works also well with short reads.<br /><br /></li>
</ul>
</li>
<li><a href="http://www.mscs.mu.edu/~bozdag/compartmentalized_assembler.html" title="Compartmentalized Assembler &ndash; Assembly of Physical Maps">Compartmentalized Assembler &ndash; Assembly of Physical Maps</a>
<ul>
<li>Compartmentalized assembler is a novel method for the assemlby of high quality physical maps from fingerprinted clones.<br /><br /></li>
</ul>
</li>
<li><a href="http://genome.jgi.doe.gov/viz/" title="Elviz &ndash; Exploration of Metagenomic Assemblies">Elviz &ndash; Exploration of Metagenomic Assemblies</a>
<ul>
<li>Elviz (Environmental Laboratory Visualization) is an interactive web-based tool for the visual exploration of assembled metagenome data and their complex metadata.<br /><br /></li>
</ul>
</li>
<li><a href="http://bs.ipm.ir/softwares/ssp/" title="SSP &ndash; de novo Transcriptome Assembler">SSP &ndash; de novo Transcriptome Assembler</a>
<ul>
<li>SSP is a de novo transcriptome assembler that assembles RNA-seq reads into transcripts. SSP aims to reconstructs all the alternatively spliced isoforms and estimates the expression level of them.<br /><br /></li>
</ul>
</li>
<li><a href="http://viramp.com/" title="VirAmp &ndash; Galaxy-based Viral Genome Assembly pipeline">VirAmp &ndash; Galaxy-based Viral Genome Assembly pipeline</a>
<ul>
<li>VirAmp is a web-based semi-de novo fast virus genome assembly pipeline designed for extremely high coverage NGS data. VirAmp is a collection of existing tools, combined into a single Galaxy interface. Users without further computational knowledge can easily operate the pipeline.<br /><br /></li>
</ul>
</li>
<li><a href="https://github.com/juliema/aTRAM" title="aTRAM&nbsp;1.04 &ndash; automated Target Restricted Assembly Method">aTRAM&nbsp;1.04 &ndash; automated Target Restricted Assembly Method</a>
<ul>
<li>aTRAM performs targeted de novo assembly of loci from paired-end Illumina runs.<br /><br /></li>
</ul>
</li>
<li><a href="http://denovoassembler.sourceforge.net/" title="Ray 2.3.1 &ndash; Parallel Genome Assemblies for Parallel DNA sequencing">Ray 2.3.1 &ndash; Parallel Genome Assemblies for Parallel DNA sequencing</a>
<ul>
<li>Ray is a parallel software that computes de novo genome assemblies with next-generation sequencing data.<br /><br /></li>
</ul>
</li>
<li><a href="http://genome.cs.nthu.edu.tw/CAR/" title="CAR &ndash; Contig Assembly of Prokaryotic Draft Genomes Using Rearrangements">CAR &ndash; Contig Assembly of Prokaryotic Draft Genomes Using Rearrangements</a>
<ul>
<li>CAR is an efficient and more accurate tool for assembling contigs of a prokaryotic draft genome based on a reference genome.<br /><br /></li>
</ul>
</li>
<li><a href="http://www.lstmed.ac.uk/vtbuilder" title="VTBuilder &ndash; Assembly of Multi Isoform Transcriptomes">VTBuilder &ndash; Assembly of Multi Isoform Transcriptomes</a>
<ul>
<li>VTBuilder is a tool for the inference of non-chimeric contigs from read data that has been sequenced from complex multi-isoformic transcriptomes, such as snake venom glands, or rapidly evolving viral populations, such as HIV-1.<br /><br /></li>
</ul>
</li>
<li><a href="http://bioinfolab.uncc.edu/TruHmm_package/" title="TruHmm &ndash; TRanscription Unit Assembly by a Hidden Markov model">TruHmm &ndash; TRanscription Unit Assembly by a Hidden Markov model</a>
<ul>
<li>TruHmm is a reference based transcriptome assembler for prokaryotes, and is suitable for assembling transcripts for directional RNA-seq library.<br /><br /></li>
</ul>
</li>
<li><a href="https://sourceforge.net/projects/rnaseqassembly/?source=navbar" title="Bridger 20141201 &ndash; RNA-Seq Assembly">Bridger 20141201 &ndash; RNA-Seq Assembly</a>
<ul>
<li>Bridger is a new de novo transcriptome assembler which takes advantage of techniques employed in Cufflinks to overcome limitations of the existing de novo assemblers.<br /><br /></li>
</ul>
</li>
<li><a href="https://sourceforge.net/projects/grasp-release/" title="GRASP 0.0.4 &ndash; Guided Reference-based Assembly of Short Peptides">GRASP 0.0.4 &ndash; Guided Reference-based Assembly of Short Peptides</a>
<ul>
<li>GRASP is a gene annotation tool for metagenomic studies. GRASP assembles the fragmented short-peptides, which are called from the NGS reads, and aligns the assembled contigs to the query reference protein. GRASP achieves much higher sensitivity than BLASTP for gene annotation purpose.<br /><br /></li>
</ul>
</li>
<li><a href="http://cortexassembler.sourceforge.net/index.html" title="Cortex 1.05.21 &ndash; Genome Assembly and Variation Analysis">Cortex 1.05.21 &ndash; Genome Assembly and Variation Analysis</a>
<ul>
<li>Cortex is an efficient and low-memory software framework for analysis of genomes using sequence data. There are two main executables, being developed in parallel streams: cortex_con (primary contact Mario Caccamo) is for consensus genome assembly, and cortex_var (primary contact Zamin Iqbal) is for variation and population assembly.<br /><br /></li>
</ul>
</li>
<li><a href="https://github.com/voutcn/megahit" title="MEGAHIT v0.1.4 &ndash; Large and Complex Metagenomics Assembly via Succinct de Bruijn graph">MEGAHIT v0.1.4 &ndash; Large and Complex Metagenomics Assembly via Succinct de Bruijn graph</a>
<ul>
<li>MEGAHIT is a single node assembler for large and complex metagenomics NGS reads, such as soil. It makes use of succinct de Bruijn graph to achieve low memory usage, whereas its goal is not to make memory usage as low as possible.<br /><br /></li>
</ul>
</li>
<li><a href="http://sb.nhri.org.tw/CISA/en/CISA" title="CISA 20140304 &ndash; Contig Integrator for Sequence Assembly">CISA 20140304 &ndash; Contig Integrator for Sequence Assembly</a>
<ul>
<li>CISA has been developed to integrate the assemblies into a hybrid set of contigs, resulting in assemblies of superior contiguity and accuracy, compared with the assemblies generated by the state-of-the-art assemblers and the hybrid assemblies merged by existing tools<br /><br /></li>
</ul>
</li>
<li><a href="http://cole-trapnell-lab.github.io/cufflinks/" title="Cufflinks 2.2.1 &ndash; Transcript Assembler &amp; Abundance Estimator for RNA-Seq">Cufflinks 2.2.1 &ndash; Transcript Assembler &amp; Abundance Estimator for RNA-Seq</a>
<ul>
<li>Cufflinks assembles transcripts, estimates their abundances, and tests for differential expression and regulation in RNA-Seq samples. It accepts aligned RNA-Seq reads and assembles the alignments into a parsimonious set of transcripts. Cufflinks then estimates the relative abundances of these transcripts based on how many reads support each one.<br /><br /></li>
</ul>
</li>
<li><a href="http://colibread.inria.fr/software/mapsembler2/" title="mapsembler 2.2.4 &ndash; Targetted Assembly of Short Sequence Reads">mapsembler 2.2.4 &ndash; Targetted Assembly of Short Sequence Reads</a>
<ul>
<li>Mapsembler is a targeted assembly software. It takes as input a set of NGS raw reads and a set of input sequences (starters). It first determines if each starter is read-coherent, e.g. whether reads confirm the presence of each starter in the original sequence. Then for each read-coherent starter, Mapsembler outputs its sequence neighborhood as a linear sequence or as a graph, depending on the user choice.<br /><br /></li>
</ul>
</li>
<li><a href="https://urgi.versailles.inra.fr/Tools/Tedna" title="Tedna 1.2.2 &ndash; Transposable Element De Novo Assembler">Tedna 1.2.2 &ndash; Transposable Element De Novo Assembler</a>
<ul>
<li>Tedna is a lightweight de novo transposable element assembler. It assembles the transposable elements directly from the raw reads.<br /><br /></li>
</ul>
</li>
<li><a href="http://chitsazlab.org/software.html" title="HyDA 1.3.1 / Squeezambler 2.0.3 &ndash; Hybrid De Novo Assembler">HyDA 1.3.1 / Squeezambler 2.0.3 &ndash; Hybrid De Novo Assembler</a>
<ul>
<li>HyDA is a multipurpose assembler, particularly tested for single cell and normal multicell genome co-assembly<br /><br /></li>
</ul>
</li>
<li><a href="https://github.com/neufeld/pandaseq" title="PANDASEQ 2.8 / Pandaseq-sam 1.3 &ndash; PAired-eND Assembler for DNA sequences">PANDASEQ 2.8 / Pandaseq-sam 1.3 &ndash; PAired-eND Assembler for DNA sequences</a>
<ul>
<li>PANDASEQ is a program to align Illumina reads, optionally with PCR primers embedded in the sequence, and reconstruct an overlapping sequence.<br /><br /></li>
</ul>
</li>
<li><a href="http://lge.ibi.unicamp.br/zorro/" title="ZORRO 2.2 &ndash; Hybrid Sequencing Technology Assembler">ZORRO 2.2 &ndash; Hybrid Sequencing Technology Assembler</a>
<ul>
<li>ZORRO is a hybrid sequencing technology assembler. It merges two sets of pre-assembled contigs into a more contiguous and consistent assembly.<br /><br /></li>
</ul>
</li>
<li><a href="http://ccb.jhu.edu/software/FLASH/" title="FLASH 1.2.11 &ndash; Fast Length Adjustment of SHort reads">FLASH 1.2.11 &ndash; Fast Length Adjustment of SHort reads</a>
<ul>
<li>FLASH (Fast Length Adjustment of SHort reads) is a very accurate fast tool to merge paired-end reads from fragments that are shorter than twice the length of reads. The extended length of reads has a significant positive impact on improvement of genome assemblies.<br /><br /></li>
</ul>
</li>
<li><a href="http://software.broadinstitute.org/allpaths-lg/blog/" title="ALLPATHS-LG 51750 &ndash; Whole Genome Shotgun Assembler">ALLPATHS-LG 51750 &ndash; Whole Genome Shotgun Assembler</a>
<ul>
<li>ALLPATHS-LG (Large Genome) is a whole genome shotgun assembler that can generate high quality assemblies from short reads. It works on both small and large (mammalian size) genomes. To use it, you should first generate ~100 base Illumina reads from two libraries: one from ~180 bp fragments, and one from ~3000 bp fragments, both at about 45x coverage. Sequence from longer fragments will enable longer-range continuity.<br /><br /></li>
</ul>
</li>
<li><a href="http://bioinformaticsonline.com/pages/view/30440/genome-assembly-tools-and-software-part2">More Tools</a> at&nbsp;http://bioinformaticsonline.com/pages/view/30440/genome-assembly-tools-and-software-part2</li>
</ul>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/30680/easybuild</guid>
	<pubDate>Fri, 27 Jan 2017 16:00:43 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/30680/easybuild</link>
	<title><![CDATA[EasyBuild]]></title>
	<description><![CDATA[<p><a href="https://github.com/hpcugent/easybuild">EasyBuild</a><span>&nbsp;is a software build and installation framework that allows you to manage (scientific) software on High Performance Computing (HPC) systems in an efficient way.</span><br><span>A full list of supported software packages is available&nbsp;</span><a href="http://easybuild.readthedocs.io/en/latest/version-specific/Supported_software.html">here</a><span>.</span></p><p>Address of the bookmark: <a href="https://hpcugent.github.io/easybuild/" rel="nofollow">https://hpcugent.github.io/easybuild/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/30701/harvest</guid>
	<pubDate>Tue, 31 Jan 2017 10:57:56 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/30701/harvest</link>
	<title><![CDATA[Harvest]]></title>
	<description><![CDATA[<p>Harvest is a suite of core-genome alignment and visualization tools for quickly analyzing thousands of intraspecific microbial genomes, including variant calls, recombination detection, and phylogenetic trees.</p>
<p><a href="http://harvest.readthedocs.io/en/latest/_images/screen.png"><img src="http://harvest.readthedocs.io/en/latest/_images/screen.png" alt="_images/screen.png" style="border: 0px;"></a><span></span></p>
<p><strong>Tools</strong></p>
<ul>
<li><a href="http://harvest.readthedocs.io/en/latest/content/parsnp.html">Parsnp</a>&nbsp;- Core-genome alignment and analysis</li>
<li><a href="http://harvest.readthedocs.io/en/latest/content/gingr.html">Gingr</a>&nbsp;- Interactive visualization of alignments, trees and variants</li>
<li><a href="http://harvest.readthedocs.io/en/latest/content/harvest-tools.html">HarvestTools</a>&nbsp;- Archiving and postprocessing</li>
</ul>
<p><strong>Citation</strong></p>
<blockquote>
<div>Treangen TJ, Ondov BD, Koren S, Phillippy AM. The Harvest suite for rapid core-genome alignment and visualization of thousands of intraspecific microbial genomes. Genome Biology, 15 (11), 1-15 [<a href="http://www.biomedcentral.com/content/pdf/s13059-014-0524-x.pdf">PDF</a>]</div>
</blockquote><p>Address of the bookmark: <a href="http://harvest.readthedocs.io/en/latest/index.html" rel="nofollow">http://harvest.readthedocs.io/en/latest/index.html</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/35621/bbtools-for-bioinformatician</guid>
	<pubDate>Thu, 15 Feb 2018 16:45:52 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/35621/bbtools-for-bioinformatician</link>
	<title><![CDATA[BBTools for bioinformatician !]]></title>
	<description><![CDATA[<p><span></span><br /><strong>BBMap.sh</strong><br /><br /></p><ul>
<li><strong>Mapping Nanopore reads</strong></li>
</ul><p><br /><span>BBMap.sh has a length cap of 6kbp. Reads longer than this will be broken into 6kbp pieces and mapped independently.</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ mapPacBio.sh -Xmx20g k=7 in=reads.fastq ref=reference.fa maxlen=1000 minlen=200 idtag ow int=f qin=33 out=mapped1.sam minratio=0.15 ignorequality slow ordered maxindel1=40 maxindel2=400</pre></div><p><br /><span>The "maxlen" flag shreds them to a max length of 1000; you can set that up to 6000. But I found 1000 gave a higher mapping rate.&nbsp;&nbsp;</span><br /><br /></p><ul>
<li><strong>Using Paired-end and single-end reads at the same time</strong></li>
</ul><p><br /><span>BBMap itself can only run single-ended or paired-ended in a single run, but it has a wrapper that can accomplish it, like this:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ bbwrap.sh in1=read1.fq,singletons.fq in2=read2.fq,null out=mapped.sam append</pre></div><p><span>This will write all the reads to the same output file but only print the headers once. I have not tried that for bam output, only sam output</span><br /><br /><span>Note about alignment stats: For paired reads, you can find the total percent mapped by adding the read 1 percent (where it says "mapped: N%") and read 2 percent, then dividing by 2. The different columns tell you the count/percent of each event. Considering the cigar strings from alignment, "Match Rate" is the number of symbols indicating a reference match (=) and error rate is the number indicating substitution, insertion, or deletion (X, I, D).</span><br /><br /></p><ul>
<li><strong>Exact matches when mapping small reads (e.g. miRNA)</strong></li>
</ul><p><br /><span>When mapping small RNA's with BBMap use the following flags to report only perfect matches.</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">ambig=all vslow perfectmode maxsites=1000</pre></div><p><span>It should be very fast in that mode (despite the vslow flag). Vslow mainly removes masking of low-complexity repetitive kmers, which is not usually a problem but can be with extremely short sequences like microRNAs.</span></p><ul>
<li><strong>Important note about BBMap alignments</strong></li>
</ul><p><br /><span>BBMap is always nondeterministic when run in paired-end mode with multiple threads, because the insert-size average is calculated on a per-thread basis, which affects mapping; and which reads are assigned to which thread is nondeterministic. The only way to avoid that would be to restrict it to a single thread (threads=1), or map the reads as single-ended and then fix pairing afterward:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">bbmap.sh in=reads.fq outu=unmapped.fq int=f
repair.sh in=unmapped.fq out=paired.fq fint outs=singletons.fq</pre></div><p><span>In this case you'd want to only keep the paired output.&nbsp;</span><br /><br /><span>BBSplit is based on BBMap, so it is also nondeterministic in paired mode with multiple threads. BBDuk and Seal (which can be used similarly to BBSplit) are always deterministic.&nbsp;</span><br /><br /><span>--------------------------------------------------------</span><br /><br /><strong>Reformat.sh</strong></p><ul>
<li><strong>Count k-mers/find unknown primers</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in=reads.fq out=trimmed.fq ftr=19</pre></div><p><span>This will trim all but the first 20 bases (all bases after position 19, zero-based).</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ kmercountexact.sh in=trimmed.fq out=counts.txt fastadump=f mincount=10 k=20 rcomp=f</pre></div><p><span>This will generate a file containing the counts of all 20-mers that occurred at least 10 times, in a 2-column format that is easy to sort in Excel.&nbsp;</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">ACCGTTACCGTTACCGTTAC	100
AAATTTTTTTCCCCCCCCCC	85</pre></div><p><span>...etc. If the primers are 20bp long, they should be pretty obvious.&nbsp;&nbsp;</span></p><ul>
<li><strong>Convert SAM format from 1.4 to 1.3 (required for many programs)</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in=reads.sam out=out.sam sam=1.3</pre></div><ul>
<li><strong>Removing N basecalls</strong></li>
</ul><p><br /><span>You can use BBDuk or Reformat with "qtrim=rl trimq=1". That will only trim trailing and leading bases with Q-score below 1, which means Q0, which means N (in either fasta or fastq format). The BBMap package automatically changes q-scores of Ns that are above 0 to 0 and called bases with q-scores below 2 to 2, since occasionally some Illumina software versions produces odd things like a handful of Q0 called bases or Ns with Q&gt;0, neither of which make any sense in the Phred scale.</span></p><ul>
<li><strong>Sampling reads</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in=reads.fq out=sampled.fq sample=3000</pre></div><div><div>Code:</div><pre dir="ltr">To sample 10% of the reads:
reformat.sh in1=reads1.fq in2=reads2.fq out1=sampled1.fq out2=sampled2.fq samplerate=0.1

or more concisely:
reformat.sh in=reads#.fq out=sampled#.fq samplerate=0.1

and for exact sampling:
reformat.sh in=reads#.fq out=sampled#.fq samplereadstarget=100k</pre></div><ul>
<li><strong>Changing fasta headers</strong></li>
</ul><p><br /><span>Remove anything after the first space in fasta header.&nbsp;</span><br /><br /></p><div><div>Code:</div><pre dir="ltr"> reformat.sh in=sequences.fasta out=renamed.fasta trd</pre></div><p><span>"trd" stands for "trim read description" and will truncate everything after the first whitespace.</span></p><ul>
<li><strong>Extract reads from a sam file</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in=reads.sam out=reads.fastq</pre></div><ul>
<li><strong>Verify pairing and optionally de-interleave the reads</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in=reads.fastq verifypairing</pre></div><ul>
<li><strong>Verify pairing if the reads are in separate files</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in1=r1.fq in2=r2.fq vpair</pre></div><p><span>If that completes successfully and says the reads were correctly paired, then you can simply de-interleave reads into two files like this:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in=reads.fastq out1=r1.fastq out2=r2.fastq</pre></div><ul>
<li><strong>Base quality histograms</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in=reads.fq qchist=qchist.txt</pre></div><p><span>That stands for "quality count histogram".&nbsp;</span></p><ul>
<li><strong>Filter SAM/BAM file by read length</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in=x.sam out=y.sam minlength=50 maxlength=200</pre></div><ul>
<li><strong>Filter SAM/BAM file to detect/filter spliced reads</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in=mapped.bam out=filtered.bam maxdellen=50</pre></div><p><span>You can set "maxdellen" to whatever length deletion event you consider the minimum to signify splicing, which depends on the organism.</span><br /><span>-------------------------------------------------------------</span><br /><strong>Repair.sh</strong></p><ul>
<li><strong>"Re-pair" out-of-order reads from paired-end data files</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ repair.sh in1=r1.fq.gz in2=r2.fq.gz out1=fixed1.fq.gz out2=fixed2.fq.gz outsingle=singletons.fq.gz</pre></div><p><span>--------------------------------------------------------------</span><br /><strong>BBMerge.sh</strong><br /><br /><span>BBMerge now has a new flag - "outa" or "outadapter". This allows you to automatically detect the adapter sequence of reads with short insert sizes, in case you don't know what adapters were used. It works like this:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ bbmerge.sh in=reads.fq outa=adapters.fa reads=1m</pre></div><p><span>Of course, it will only work for paired reads! The output fasta file will look like this:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">&gt;Read1_adapter
GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG
&gt;Read2_adapter
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG</pre></div><p><span>If you have multiplexed things with different barcodes in the adapters, the part with the barcode will show up as Ns, like this:</span><br /><br /><span>GATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG&nbsp;&nbsp;</span><br /><br /><span>Note: For BBMerge with micro-RNA, you need to add the flag&nbsp;</span><strong>mininsert=17</strong><span>. The default is 35, which is too long for micro-RNA libraries.&nbsp;</span></p><ul>
<li><strong>Identifying adapters</strong></li>
</ul><p><span>If you have paired reads, and enough of the reads have inserts shorter than read length, you can identify adapter sequences with BBMerge, like this (they will be printed to adapters.fa):</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ bbmerge.sh in1=r1.fq in2=r2.fq outa=adapters.fa</pre></div><p><br /><span>-----------------------------------------------------------------</span><br /><br /><strong>BBDuk.sh</strong><br /><br /><span>Note: BBDuk is strictly deterministic on a per-read basis, however it does by default reorder the reads when run multithreaded. You can add the flag "ordered" to keep output reads in the same order as input reads</span></p><ul>
<li><strong>Finding reads with a specific sequence at the beginning of read</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ bbduk.sh -Xmx1g in=reads.fq outm=matched.fq outu=unmatched.fq restrictleft=25 k=25 literal=AAAAACCCCCTTTTTGGGGGAAAAA</pre></div><p><span>In this case, all reads starting with "AAAAACCCCCTTTTTGGGGGAAAAA" will end up in "matched.fq" and all other reads will end up in "unmatched.fq". Specifically, the command means "look for 25-mers in the leftmost 25 bp of the read", which will require an exact prefix match, though you can relax that if you want.</span><br /><br /><span>So you could bin all the reads with your known sequence, then look at the remaining reads to see what they have in common. You can do the same thing with the tail of the read using "restrictright" instead, though you can't use both restrictions at the same time.&nbsp;&nbsp;</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ bbduk.sh in=reads.fq outm=matched.fq literal=NNNNNNCCCCGGGGGTTTTTAAAAA k=25 copyundefined</pre></div><p><span>With the "copyundefined" flag, a copy of each reference sequence will be made representing every valid combination of defined letter. So instead of increasing memory or time use by 6^75, it only increases them by 4^6 or 4096 which is completely reasonable, but it only allows substitutions at predefined locations. You can use the "copyundefined", "hdist", and "qhdist" flags together for a lot of flexibility - for example, hdist=2 qhdist=1 and 3 Ns in the reference would allow a hamming distance of 6 with much lower resource requirements than hdist=6. Just be sure to give BBDuk as much memory as possible.</span></p><ul>
<li><strong>Removing illumina adapters (if exact adapters not known)</strong></li>
</ul><p><br /><span>If you're not sure which adapters are used, you can add "ref=truseq.fa.gz,truseq_rna.fa.gz,nextera.fa.gz" and get them all (this will increase the amount of overtrimming, though it should still be negligible).&nbsp;</span></p><ul>
<li><strong>Removing illumina control sequences/phiX reads</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">bbduk.sh in=trimmed.fq.gz out=filtered.fq.gz k=31 ref=artifacts,phix ordered cardinality</pre></div><ul>
<li><strong>Identify certain reads that contain a specific sequence</strong></li>
</ul><div><div>Code:</div><pre dir="ltr">$ bbduk.sh in=reads.fq out=unmatched.fq outm=matched.fq literal=ACGTACGTACGTACGTAC k=18 mm=f hdist=2</pre></div><p><span>Make sure "k" is set to the exact length of the sequence. "hdist" controls the number of substitutions allowed. "outm" gets the reads that match. By default this also looks for the reverse-complement; you can disable that with "rcomp=f".&nbsp;&nbsp;</span></p><ul>
<li><strong>Extract sequences that share kmers with your sequences with BBDuk</strong></li>
</ul><div><div>Code:</div><pre dir="ltr">$ bbduk.sh in=a.fa ref=b.fa out=c.fa mkf=1 mm=f k=31</pre></div><p><span>This will print to C all the sequences in A that share 100% of their 31-mers with sequences in B.&nbsp;</span><br /><br /></p><ul>
<li><strong>Extract sequences that contain N's with BBDuk</strong></li>
</ul><div><div>Code:</div><pre dir="ltr">bbduk.sh in=reads.fq out=readsWithoutNs.fq outm=readsWithNs.fq maxns=0</pre></div><p><span>If you have, say, 100bp reads and only want to separate reads containing all 100 Ns, change that to "maxns=99".</span><br /><br /><strong>General notes for BBDuk.sh</strong><span>&nbsp;</span><br /><br /><span>BBDuk can operate in one of 4 kmer-matching modes:</span><br /><span>Right-trimming (ktrim=r), left-trimming (ktrim=l), masking (ktrim=n), and filtering (default). But it can only do one at a time because all kmers are stored in a single table. It can still do non-kmer-based operations such as quality trimming at the same time.</span><br /><br /><span>BBDuk2 can do all 4 kmer operations at once and is designed for integration into automated pipelines where you do contaminant removal and adapter-trimming in a single pass to minimize filesystem I/O. Personally, I never use BBDuk2 from the command line. Both have identical capabilities and functionality otherwise, but the syntax is different.</span><br /><br /><span>------------------------------------------------------------------</span><br /><br /><strong>Randomreads.sh</strong></p><ul>
<li><strong>Generate random reads in various formats</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ randomreads.sh ref=genome.fasta out=reads.fq len=100 reads=10000</pre></div><p><span>You can specify paired reads, an insert size distribution, read lengths (or length ranges), and so forth. But because I developed it to benchmark mapping algorithms, it is specifically designed to give excellent control over mutations. You can specify the number of snps, insertions, deletions, and Ns per read, either exactly or probabilistically; the lengths of these events is individually customizable, the quality values can alternately be set to allow errors to be generated on the basis of quality; there's a PacBio error model; and all of the reads are annotated with their genomic origin, so you will know the correct answer when mapping.</span><br /><br /><span>Bear in mind that 50% of the reads are going to be generated from the plus strand and 50% from the minus strand. So, either a read will match the reference perfectly, OR its reverse-complement will match perfectly.</span><br /><br /><span>You can generate the same set of reads with and without SNPs by fixing the seed to a positive number, like this:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ randomreads.sh maxsnps=0 adderrors=false out=perfect.fastq reads=1000 minlength=18 maxlength=55 seed=5

$ randomreads.sh maxsnps=2 snprate=1 adderrors=false out=2snps.fastq reads=1000 minlength=18 maxlength=55 seed=5</pre></div><p><span>[As of BBmap v. 36.59] rendomreads.sh gains the ability to simulate metagenomes.&nbsp;</span><br /><br /><span>coverage=X will automatically set "reads" to a level that will give X average coverage (decimal point is allowed).</span><br /><br /><span>metagenome will assign each scaffold a random exponential variable, which decides the probability that a read be generated from that scaffold. So, if you concatenate together 20 bacterial genomes, you can run randomreads and get a metagenomic-like distribution. It could also be used for RNA-seq when using a transcriptome reference.</span><br /><br /><span>The coverage is decided on a per-reference-sequence level, so if a bacterial assembly has more than one contig, you may want to glue them together first with fuse.sh before concatenating them with the other references.&nbsp;</span><br /><br /></p><ul>
<li><strong>Simulate a jump library</strong></li>
</ul><p><br /><span>You can simulate a 4000bp jump library from your existing data like this.</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ cat assembly1.fa assembly2.fa &gt; combined.fa
$ bbmap.sh ref=combined.fa
$ randomreads.sh reads=1000000 length=100 paired interleaved mininsert=3500 maxinsert=4500 bell perfect=1 q=35 out=jump.fq.gz</pre></div><p><span>--------------------------------------------------------------</span><br /><strong>Shred.sh</strong><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ shred.sh in=ref.fasta out=reads.fastq length=200</pre></div><p><span>The difference is that RandomReads will make reads in a random order from random locations, ensuring flat coverage on average, but it won't ensure 100% coverage unless you generate many fold depth. Shred, on the other hand, gives you exactly 1x depth and exactly 100% coverage (and is not capable of modelling errors). So, the use-cases are different.&nbsp;</span><br /><span>---------------------------------------------------------------</span><br /><strong>Demuxbyname.sh</strong></p><ul>
<li><strong>Demultiplex fastq files when the tag is present in the fastq read header (illumina)</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ demuxbyname.sh in=r#.fq out=out_%_#.fq prefixmode=f names=GGACTCCT+GCGATCTA,TAAGGCGA+TCTACTCT,...
outu=filename</pre></div><p><span>"Names" can also be a text file with one barcode per line (in exactly the format found in the read header). You do have to include all of the expected barcodes, though.</span><br /><br /><span>In the output filename, the "%" symbol gets replaced by the barcode; in both the input and output names, the "#" symbol gets replaced by 1 or 2 for read 1 or read 2. It's optional, though; you can leave it out for interleaved input/output, or specify in1=/in2=/out1=/out2= if you want custom naming.</span><br /><br /><span>----------------------------------------------------------------</span><br /><br /><strong>Readlength.sh</strong></p><ul>
<li><strong>Plotting the length distribution of reads</strong></li>
</ul><div><div>Code:</div><pre dir="ltr">$ readlength.sh in=file out=histogram.txt bin=10 max=80000</pre></div><p><span>That will plot the result in bins of size 10, with everything above 80k placed in the same bin. The defaults are set for relatively short sequences so if they are many megabases long you may need to add the flag "-Xmx8g" and increase "max=" to something much higher.</span><br /><br /><span>Alternatively, if these are assemblies and you're interested in continuity information (L50, N50, etc), you can run stats on each or statswrapper on all of them:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">stats.sh in=file</pre></div><p><span>or</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">statswrapper.sh in=file,file,file,file&hellip;</pre></div><p><span>----------------------------------------------------------------</span><br /><strong>Filterbyname.sh</strong><br /><br /><span>By default, "filterbyname" discards reads with names in your name list, and keeps the rest. To include them and discard the others, do this:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ filterbyname.sh in=003.fastq out=filter003.fq names=names003.txt include=t</pre></div><p><span>----------------------------------------------------------------</span><br /><strong>getreads.sh</strong><br /><br /><span>If you only know the number(s) of the fasta/fastq record(s) in a file (records start at 0) then you can use the following command to extract those reads in a new file.</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ getreads.sh in= id=&lt;number,number,number...&gt; out=</pre></div><p><span>The first read (or pair) has ID 0, the second read (or pair) has ID 1, etc.</span><br /><br /><span>Parameters:</span><br /><span>in= Specify the input file, or stdin.</span><br /><span>out= Specify the output file, or stdout.</span><br /><span>id= Comma delimited list of numbers or ranges, in any order.</span><br /><span>For example: id=5,93,17-31,8,0,12-13&nbsp;</span><br /><span>----------------------------------------------------------------</span><br /><strong>Splitsam.sh</strong></p><ul>
<li><strong>Splits a sam file into forward and reverse reads</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">splitsam.sh mapped.sam plus.sam minus.sam unmapped.sam
reformat.sh in=plus.sam out=plus.fq
reformat.sh in=minus.sam out=minus.fq rcomp</pre></div><p><span>----------------------------------------------------------------</span><br /><strong>BBSplit.sh</strong><br /><br /><span>BBSplit now has the ability to output paired reads in dual files using the # symbol. For example:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ bbsplit.sh ref=x.fa,y.fa in1=read1.fq in2=read2.fq basename=o%_#.fq</pre></div><p><span>will produce ox_1.fq, ox_2.fq, oy_1.fq, and oy_2.fq</span><br /><br /><span>You can use the # symbol for input also, like "in=read#.fq", and it will get expanded into 1 and 2.&nbsp;&nbsp;</span><br /><br /><strong>Added feature:&nbsp;</strong><span>One can specify a directory for the "ref=" argument. If anything in the list is a directory, it will use all fasta files in that directory. They need a fasta extension, like .fa or .fasta, but can be compressed with an additional .gz after that. Reason this is useful is to use BBSplit is to have it split input into one output file per reference file.</span><br /><br /><br /><strong>NOTE: 1</strong><span>&nbsp;By default BBSplit uses fairly strict mapping parameters; you can get the same sensitivity as BBMap by adding the flags "minid=0.76 maxindel=16k minhits=1". With those parameters it is extremely sensitive.</span><br /><br /><strong>NOTE: 2</strong><span>&nbsp;BBSplit has different ambiguity settings for dealing with reads that map to multiple genomes. In any case, if the alignment score is higher to one genome than another, it will be associated with that genome only (this considers the combined scores of read pairs - pairs are always kept together). But when a read or pair has two identically-scoring mapping locations, on different genomes, the behavior is controlled by the "ambig2" flag - "ambig2=toss" will discard the read, "all" will send it to all output files, and "split" will send it to a separate file for ambiguously-mapped reads (one per genome to which it maps).</span><br /><br /><strong>NOTE: 3</strong><span>&nbsp;Zero-count lines are suppressed by default, but they should be printed if you include the flag "nzo=f" (nonzeroonly=false).&nbsp;</span><br /><br /><strong>NOTE: 4</strong><span>&nbsp;BBSplit needs multiple reference files as input; one per organism, or one for target and another for everything else. It only outputs one file per reference file.</span><br /><br /><span>Seal.sh, on the other hand, which is similar, can use a single concatenated file, as it (by default) will output one file per reference sequence within a concatenated set of references.&nbsp;</span><br /><span>--------------------------------------------------------------</span><br /><strong>Pileup.sh</strong></p><ul>
<li><strong>To generate transcript coverage stats</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ pileup.sh in=mapped.sam normcov=normcoverage.txt normb=20 stats=stats.txt</pre></div><p><span>That will generate coverage per transcript, with 20 lines per transcript, each line showing the coverage for that fraction of the transcript. "stats" will contain other information like the fraction of bases in each transcript that was covered.&nbsp;</span></p><ul>
<li><strong>To calculate physical coverage stats (region covered by paired-end reads)&nbsp;</strong></li>
</ul><p><span>BBMap has a "physcov" flag that allows it to report physical rather than sequenced coverage. It can be used directly in BBMap, or with pileup, if you already have a sam file. For example:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ pileup.sh in=mapped.sam covstats=coverage.txt</pre></div><ul>
<li><strong>Calculating coverage of the genome</strong></li>
</ul><p><br /><span>Program will take sam or bam, sorted or unsorted.</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ pileup.sh in=mapped.sam out=stats.txt hist=histogram.txt</pre></div><p><span>stats.txt will contain the average depth and percent covered of each reference sequence; the histogram will contain the exact number of bases with a each coverage level. You can also get per-base coverage or binned coverage if you want to plot the coverage. It also generates median and standard deviation, and so forth.</span><br /><br /><span>It's also possible to generate coverage directly from BBMap, without an intermediate sam file, like this:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ bbmap.sh in=reads.fq ref=reference.fasta nodisk covstats=stats.txt covhist=histogram.txt</pre></div><p><span>We use this a lot in situations where all you care about is coverage distributions, which is somewhat common in metagenome assemblies. It also supports most of the flags that pileup.sh supports, though the syntax is slightly different to prevent collisions. In each case you can see all the possible flags by running the shellscript with no arguments.</span></p><ul>
<li><strong>To bin aligned reads</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ pileup.sh in=mapped.sam out=stats.txt bincov=coverage.txt binsize=1000</pre></div><p><span>That will give coverage within each bin. For read density regardless of read length, add the "startcov=t" flag.&nbsp;&nbsp;</span><br /><br /><span>--------------------------------------------------------------</span><br /><strong>Dedupe.sh</strong><br /><br /><span>Dedupe ensures that there is at most one copy of any input sequence, optionally allowing contaminants (substrings) to be removed, and a variable hamming or edit distance to be specified. Usage:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ dedupe.sh in=assembly1.fa,assembly2.fa out=merged.fa</pre></div><p><span>That will absorb exact duplicates and containments. You can use "hdist" and "edist" flags to allow mismatches, or get a complete list of flags by running the shellscript with no arguments.&nbsp;&nbsp;</span><br /><br /><span>Dedupe&nbsp;</span><span style="text-decoration: underline;">will merge assemblies</span><span>, but it&nbsp;</span><span style="text-decoration: underline;">will not produce consensus sequences or join overlapping reads</span><span>; it only removes sequences that are fully contained within other sequences (allowing the specified number of mismatches or edits).</span><br /><br /><span>Dedupe can remove duplicate reads from multiple files simultaneously, if they are comma-delimited (e.g. in=file1.fastq,file2.fastq,file3.fastq). And if you set the flag "uniqueonly=t" then ALL copies of duplicate reads will be removed, as opposed to the default behavior of leaving one copy of duplicate reads.</span><br /><br /><span>However, it does not care which file a read came from; in other words, it can't remove only reads that are duplicates across multiple files but leave the ones that are duplicates within a file. That can still be accomplished, though, like this:</span><br /><br /><span>1) Run dedupe on each sample individually, so now there are at most 1 copy of a read per sample.</span><br /><span>2) Run dedupe again on all of the samples together, with "uniqueonly=t". The only remaining duplicate reads will be the ones duplicated between samples, so that's all that will be removed.&nbsp;&nbsp;</span><br /><br /><span>--------------------------------------------------------------</span></p><ul>
<li><strong>Generate ROC curves from any aligner</strong></li>
</ul><p><br /><strong>[*]index the reference<br /><br /></strong></p><div><div>Code:</div><pre dir="ltr">$ bbmap.sh ref=reference.fasta</pre></div><p><br /><strong>[*]Generate random reads</strong><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ randomreads.sh reads=100000 length=100 out=synth.fastq maxq=35 midq=25 minq=15</pre></div><p><strong>[*]Map to produce a sam file</strong><br /><br /><span>...substitute this command with the appropriate one from your aligner of choice</span></p><div><div>Code:</div><pre dir="ltr">$ bbmap.sh in=synth.fq out=mapped.sam</pre></div><p><strong>[*]Generate ROC curve</strong><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ samtoroc.sh in=mapped.sam reads=100000</pre></div><p><span>--------------------------------------------------------------</span></p><ul>
<li><strong>Calculate heterozygous rate for sequence data</strong></li>
</ul><p><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ kmercountexact.sh in=reads.fq khist=histogram.txt peaks=peaks.txt</pre></div><p><span>You can examine the histogram manually, or use the "peaks" file which tells you the number of unique kmers in each peak on the histogram. For a diploid, the first peak will be the het peak, the second will be the homozygous peak, and the rest will be repeat peaks. The peak caller is not perfect, though, so particularly with noisy data I would only rely on it for the first two peaks, and try to quantify the higher-order peaks manually if you need to (which you generally don't).</span><br /><br /><span>-----------------------------------------------------------------</span></p><ul>
<li><strong>Compare mapped reads between two files</strong></li>
</ul><p><br /><span>To see how many mapped reads (can be mapped concordant or discordant, doesn't matter) are shared between the two alignment files and how many mapped reads are unique to one file or the other.</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in=file1.sam out=mapped1.sam mappedonly
$ reformat.sh in=file2.sam out=mapped2.sam mappedonly</pre></div><p><span>That gets you the mapped reads only. Then:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ filterbyname.sh in=mapped1.sam names=mapped2.sam out=shared.sam include=t</pre></div><p><span>...which gets you the set intersection;</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ filterbyname.sh in=mapped1.sam names=mapped2.sam out=only1.sam include=f
$ filterbyname.sh in=mapped2.sam names=mapped1.sam out=only2.sam include=f</pre></div><p><span>...which get you the set subtractions.&nbsp;&nbsp;</span><br /><br /><span>--------------------------------------------------------------</span><br /><br /><strong>BBrename.sh</strong></p><div><div>Code:</div><pre dir="ltr">$ bbrename.sh in=old.fasta out=new.fasta</pre></div><p><span>That will rename the reads as 1, 2, 3, 4, ... 222.</span><br /><br /><span>You can also give a custom prefix if you want. The input has to be text format, not .doc.&nbsp;&nbsp;</span><br /><br /><span>---------------------------------------------------------------------</span><br /><br /><strong>BBfakereads.sh</strong></p><ul>
<li><strong>Generating &ldquo;fake&rdquo; paired end reads from a single end read file</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ bfakereads.sh in=reads.fastq out1=r1.fastq out2=r2.fastq length=100</pre></div><p><span>That will generate fake pairs from the input file, with whatever length you want (maximum of input read length). We use it in some cases for generating a fake LMP library for scaffolding from a set of contigs. Read 1 will be from the left end, and read 2 will be reverse-complemented and from the right end; both will retain the correct original qualities. And " /1" " /2" will be suffixed after the read name.&nbsp;&nbsp;</span><br /><br /><span>------------------------------------------------------------------</span><br /><strong>Randomreads.sh</strong></p><ul>
<li><strong>Generate random reads</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ randomreads.sh ref=genome.fasta out=reads.fq len=100 reads=10000</pre></div><p><span>"seed=-1" will use a random seed; any other value will use that specific number as the seed</span><br /><br /><span>You can specify paired reads, an insert size distribution, read lengths (or length ranges), and so forth. But because I developed it to benchmark mapping algorithms, it is specifically designed to give excellent control over mutations. You can specify the number of snps, insertions, deletions, and Ns per read, either exactly or probabilistically; the lengths of these events is individually customizable, the quality values can alternately be set to allow errors to be generated on the basis of quality; there's a PacBio error model; and all of the reads are annotated with their genomic origin, so you will know the correct answer when mapping.</span><br /><br /><span>--------------------------------------------------------------------</span></p><ul>
<li><strong>Generate saturation curves to assess sequencing depth</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ bbcountunique.sh in=reads.fq out=histogram.txt</pre></div><p><span>It works by pulling kmers from each input read, and testing whether it has been seen before, then storing it in a table.</span><br /><br /><span>The bottom line, "first", tracks whether the first kmer of the read has been seen before (independent of whether it is read 1 or read 2).</span><br /><br /><span>The top line, "pair", indicates whether a combined kmer from both read 1 and read 2 has been seen before. The other lines are generally safe to ignore but they track other things, like read1- or read2-specific data, and random kmers versus the first kmer.</span><br /><br /><span>It plots a point every X reads (configurable, default 25000).</span><br /><br /><span>In noncumulative mode (default), a point indicates "for the last X reads, this percentage had never been seen before". In this mode, once the line hits zero, sequencing more is not useful.</span><br /><br /><span>In cumulative mode, a point indicates "for all reads, this percentage had never been seen before", but still only one point is plotted per X reads.</span><br /><br /><span>-----------------------------------------------------------------</span><br /><strong>CalcTrueQuality.sh</strong><br /><br /><a href="http://seqanswers.com/forums/showthread.php?p=170904" target="_blank">http://seqanswers.com/forums/showthread.php?p=170904</a><br /><br /><span>In light of the quality-score issues with the NextSeq platform, and the possibility of future Illumina platforms (HiSeq 3000 and 4000) also using quantized quality scores, I developed it for recalibrating the scores to ensure accuracy and restore the full range of values.</span><br /><br /><span>-----------------------------------------------------------------</span><br /><br /><strong>BBMapskimmer.sh</strong><br /><br /><span>BBMap is designed to find the best mapping, and heuristics will cause it to ignore mappings that are valid but substantially worse. Therefore, I made a different version of it, BBMapSkimmer, which is designed to find all of the mappings above a certain threshold. The shellscript is bbmapskimmer.sh and the usage is similar to bbmap.sh or mapPacBio.sh. For primers, which I assume will be short, you may wish to use a lower than default K of, say, 10 or 11, and add the "slow" flag.</span><br /><br /><span>--------------------------------------------------------------</span><br /><br /><strong>msa.sh and curprimers.sh</strong><br /><br /><span>Quoted from Brian's response directly.</span><br /><br /><span>I also wrote another pair of programs specifically for working with primer pairs, msa.sh and cutprimers.sh. msa.sh will forcibly align a primer sequence (or a set of primer sequences) against a set of reference sequences to find the single best matching location per reference sequence - in other words, if you have 3 primers and 100 ref sequences, it will output a sam file with exactly 100 alignments - one per ref sequence, using the primer sequence that matched best. Of course you can also just run it with 1 primer sequence.</span><br /><br /><span>So you run msa twice - once for the left primer, and once for the right primer - and generate 2 sam files. Then you feed those into cutprimers.sh, which will create a new fasta file containing the sequence between the primers, for each reference sequence. We used these programs to synthetically cut V4 out of full-length 16S sequences.</span><br /><br /><span>I should say, though, that the primer sites identified are based on the normal BBMap scoring, which is not necessarily the same as where the primers would bind naturally, though with highly conserved regions there should be no difference.</span><br /><br /><span>------------------------------------------------------</span><br /><strong>testformat.sh</strong><br /><br /><strong>Identify type of Q-score encoding in sequence files</strong><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ testformat.sh in=seq.fq.gz
sanger    fastq    gz    interleaved    150bp</pre></div><p><span>--------------------------------------------------</span><br /><strong>kcompress.sh</strong><br /><br /><span>Newest member of BBTools. Identify constituent k-mers.&nbsp;</span><br /><a href="http://seqanswers.com/forums/showthread.php?t=63258" target="_blank">http://seqanswers.com/forums/showthread.php?t=63258</a><br /><br /><span>----------------------------------------------------</span><br /><strong>commonkmers.sh</strong><br /><br /><span>Find all k-mers for a given sequence.</span></p><div><div>Code:</div><pre dir="ltr">$ commonkmers.sh in=reads.fq out=kmers.txt k=4 count=t display=999</pre></div><p><span>Will produce output that looks like</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">MISEQ05:239:000000000-A74HF:1:2110:14788:23085	ATGA=8	ATGC=6	GTCA=6	AAAT=5	AAGC=5	AATG=5	AGCA=5	ATAA=5	ATTA=5	CAAA=5	CATA=5	CATC=5	CTGC=5	AACC=4	AACG=4	AAGA=4	ACAT=4	ACCA=4	AGAA=4	ATCA=4	ATGG=4	CAAG=4	CCAA=4	CCTC=4	CTCA=4	CTGA=4	CTTC=4	GAGC=4	GGTA=4	GTAA=4	GTTA=4	AAAA=3	AAAC=3	AAGT=3	ACCG=3	ACGG=3	ACTG=3	AGAT=3	AGCT=3	AGGA=3	AGTA=3	AGTC=3	CAGC=3	CATG=3	CGAG=3	CGGA=3	CGTC=3	CTAA=3	CTCC=3	CTTA=3	GAAA=3	GACA=3	GACC=3	GAGA=3	GCAA=3	GGAC=3	TCAA=3	TGCA=3	AAAG=2	AACA=2	AATA=2	AATC=2	ACAA=2	ACCC=2	ACCT=2	ACGA=2	ACGC=2	AGAC=2	AGCG=2	AGGC=2	CAAC=2	CAGG=2	CCGC=2	GCCA=2	GCTA=2	GGAA=2	GGCA=2	TAAA=2	TAGA=2	TCCA=2	TGAA=2	AAGG=1	AATT=1	ACGT=1	AGAG=1	AGCC=1	AGGG=1	ATAC=1	ATAG=1	ATTG=1	CACA=1	CACG=1	CAGA=1	CCAC=1	CCCA=1	CCGA=1	CCTA=1	CGAC=1	CGCA=1	CGCC=1	CGCG=1	CGTA=1	CTAC=1	GAAC=1	GCGA=1	GCGC=1	GTAC=1	GTGA=1	TTAA=1</pre></div><p><span>-----------------------------------------------------</span><br /><strong>Mutate.sh</strong><br /><br /><span>Simulate multiple mutants from a known reference (e.g.&nbsp;</span><em>E. coli</em><span>).</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ mutate.sh in=e_coli.fasta out=mutant.fasta id=99 
$ randomreads.sh ref=mutant.fasta out=reads.fq.gz reads=5m length=150 paired adderrors</pre></div><p><span>That will create a mutant version of E.coli with 99% identity to the original, and then generate 5 million simulated read pairs from the new genome. You can repeat this multiple times; each mutant will be different.</span><br /><br /><span>------------------------------------</span><br /><br /><strong>Partition.sh</strong><br /><br /><span>One can partition a large dataset with partition.sh into smaller subsets (example below splits data into 8 chunks).</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">partition.sh in=r1.fq in2=r2.fq out=r1_part%.fq out2=r2_part%.fq ways=8</pre></div><p><span>-----------------------------------</span><br /><strong>clumpify.sh</strong><br /><br /><span>If you are concerned about file size and want the files to be as small as possible, give Clumpify a try. It can reduce filesize by around 30% losslessly by reordering the reads. I've found that this also typically accelerates subsequent analysis pipelines by a similar factor (up to 30%). Usage:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">clumpify.sh in=reads.fastq.gz out=clumped.fastq.gz</pre></div><div><div>Code:</div><pre dir="ltr">clumpify.sh in1=reads_R1.fastq.gz in2=reads_R2.fastq.gz out1=clumped_R1.fastq.gz out2=clumped_R2.fastq.gz</pre></div><ul>
<li><strong>Clumpify.sh can now mark/remove sequence duplicates (optical/PCR/otherwise) from NGS data</strong></li>
</ul><p><br /><span>This does NOT require alignments so it should prove more useful compared to Picard MarkDuplicates. Relevant options for clumpify.sh command are listed below.</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">dedupe=f optical=f (default)
Nothing happens with regards to duplicates.

dedupe=t optical=f
All duplicates are detected, whether optical or not.  All copies except one are removed for each duplicate.

dedupe=f optical=t
Nothing happens.

dedupe=t optical=t

Only optical duplicates (those with an X or Y coordinate within dist) are detected.  All copies except one are removed for each duplicate.
The allduplicates flag makes all copies of duplicates removed, rather than leaving a single copy.  But like optical, it has no effect unless dedupe=t.

Note: If you set "dupedist" to anything greater than 0, "optical" gets enabled automatically.</pre></div><p><span>-------------------------------------</span><br /><strong>fuse.sh</strong><br /><br /><span>Fuse will automatically reverse-complement read 2. Pad (N) amount can be adjusted as necessary. This will for example create a full size amplicon that can be used for alignments.</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">fuse.sh in1=r1.fq in2=r2.fq pad=130 out=fused.fq fusepairs</pre></div>]]></description>
	<dc:creator>Surabhi Chaudhary</dc:creator>
</item>

</channel>
</rss>