<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/9639?offset=1260</link>
	<atom:link href="https://bioinformaticsonline.com/related/9639?offset=1260" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/2560/great-place-to-study-bioinformatics-in-europe</guid>
	<pubDate>Sun, 18 Aug 2013 18:41:34 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/2560/great-place-to-study-bioinformatics-in-europe</link>
	<title><![CDATA[Great Place to Study Bioinformatics in Europe]]></title>
	<description><![CDATA[<p>Study bioinformatics is like being jack of all trade so it is important you choose where it will be good backup of computer science, and natural science infrastructure and faculty. Especially having a good teachers in computer science is indispensible.&nbsp;</p><p><strong>Few places in Europe where good (and @some places no tution fees) master bioinformatics courses and recommended are</strong>:</p><p><strong>KU Leuven, Belgium</strong></p><p><a href="http://onderwijsaanbod.kuleuven.be/opleidingen/e/CQ_50269018.htm">http://onderwijsaanbod.kuleuven.be/opleidingen/e/CQ_50269018.htm</a></p><p><strong>ETH, Zurich</strong></p><p><a href="http://www.cbb.ethz.ch/">http://www.cbb.ethz.ch/</a></p><p><strong>University of Copenhagen, Denmark</strong></p><p><a href="http://studies.ku.dk/masters/bioinformatics/">http://studies.ku.dk/masters/bioinformatics/</a></p><p><strong>University of Helsinki, Finland</strong></p><p><a href="http://www.cs.helsinki.fi/en/mbi/">http://www.cs.helsinki.fi/en/mbi/</a></p><p><strong>Stockholm University, Sweden</strong></p><p><a href="http://www.sbc.su.se/masters/">http://www.sbc.su.se/masters/</a></p><p><strong>Universities in Netherlands</strong></p><p><a href="http://www.nbic.nl/education/msc-programmes/">http://www.nbic.nl/education/msc-programmes/</a></p><p><strong>TUM , Munich Germany</strong></p><p><a href="http://www.mastersportal.eu/studies/865/bioinformatics.html">http://www.mastersportal.eu/studies/865/bioinformatics.html</a></p><p><strong>University of Bergen, Norway</strong></p><p><a href="http://www.uib.no/en/studieprogram/MAMN-INF/BI/plan">http://www.uib.no/en/studieprogram/MAMN-INF/BI/plan</a></p><p><strong>Goethe-University in Frankfurt am Main</strong></p><p><a href="http://www.uni-frankfurt.de/58444439/mabi">http://www.uni-frankfurt.de/58444439/mabi</a></p><p><strong>Other links</strong>:</p><p><a href="http://www.masterstudies.com/Masters-Degree/Bioinformatics/Europe/">http://www.masterstudies.com/Masters-Degree/Bioinformatics/Europe/</a></p><p><a href="https://studyinsweden.se/programmes/?query=bioinformatics&amp;period=ht-2016&amp;level=ma&amp;subject=natural-science&amp;university=#search">https://studyinsweden.se/programmes/?query=bioinformatics&amp;period=ht-2016&amp;level=ma&amp;subject=natural-science&amp;university=#search</a></p><p>&nbsp;</p>]]></description>
	<dc:creator>Rahul Agarwal</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/4211/socbin-bioinformatics-2014</guid>
  <pubDate>Tue, 03 Sep 2013 18:50:20 -0500</pubDate>
  <link></link>
  <title><![CDATA[SocBiN Bioinformatics 2014]]></title>
  <description><![CDATA[
<p>14th annual conference in Bioinformatics</p>

<p>Date : June 10-13</p>

<p>Organizers: The Society for Bioinformatics in Northern European countries (SocBiN) and the Norwegian Bioinformatics Platform / ELIXIR.NO </p>

<p>Venue: Department of Informatics, University of Oslo, Norway</p>

<p>Topics:<br />Tools and technologies for integrative bioinformatics<br />Metagenomics<br />Comparative genomics and phylogeny<br />Post-ENCODE bioinformatics<br />Gene regulation<br />Cancer genomes<br />Marine genomics</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/7362/junior-research-fellow-jrf-project-fellow-kalasalingam-university</guid>
  <pubDate>Thu, 19 Dec 2013 13:23:39 -0600</pubDate>
  <link></link>
  <title><![CDATA[Junior Research Fellow (JRF) / Project Fellow @ Kalasalingam University]]></title>
  <description><![CDATA[
<p>Applications are invited from interested candidates for the post of one Junior Research Fellow / Project Fellow on a purely temporary basis in a time bound research project (3 years) sponsored by Science and Engineering Research Board, Government of India, New Delhi.</p>

<p>Name of the fellowship: Junior Research Fellow (JRF) / Project Fellow</p>

<p>Title of the project: Genome-wide Mapping of Murine Specific Dengue T-cell Epitopes: Computational Prediction, Identification and use as Candidate Vaccines</p>

<p>Duration: 3 years</p>

<p>Fellowship: Rs. 18,000 for first 2 years and Rs. 20,000 for 3rdyear (for M.Tech. candidates)</p>

<p>Rs. 16,000 for first 2 years and Rs. 18,000 for 3rdyear (for M.Sc. candidates with NET qualification)</p>

<p>Rs. 8,000 for first 2 years and Rs. 10,000 for 3rdyear (for M.Sc. candidates without NET qualification)</p>

<p>Qualifications: M.Tech. in Biotechnology / M.Sc. in any branch of Life Sciences</p>

<p>Desirable Experience: Minimum of two years research experience in any of the following areas: Immunology / Microbiology / Gene Manipulation / Bioinformatics</p>

<p>Interested and eligible candidates may apply with their resume along with relevant documents and a passport size photograph to the Principal Investigator by post (or e-mail) on or before December 31, 2013. Only short listed candidates will be called for written test and/or interview. Selected candidate may register for PhD in Kalasalingam University. No TA/DA will be paid for attending interview.</p>

<p>Dr. K. Sundar<br />Principal Investigator (SERB Project)<br />Department of Biotechnology<br />Kalasalingam University<br />Krishnankoil – 626126, Tamil Nadu<br />sundarkr@klu.ac.in</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/7812/bioinformatics-infrastructure-speed-up-indian-agriculture</guid>
	<pubDate>Tue, 07 Jan 2014 12:44:44 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/7812/bioinformatics-infrastructure-speed-up-indian-agriculture</link>
	<title><![CDATA[Bioinformatics infrastructure speed up Indian agriculture]]></title>
	<description><![CDATA[<p>"<span>Realizing the paradigm shift it can bring about, the government is focusing on increased bioinformatics intervention in agri-sciences. Currently under process, the national grid on bioinformatics is expected make much better sense out of huge genomic" - </span></p><p><span></span><a href="http://www.biospectrumindia.com/biospecindia/features/203849/supercomputing-indian-agriculture-fast-track-mode/page/1">http://www.biospectrumindia.com/biospecindia/features/203849/supercomputing-indian-agriculture-fast-track-mode/page/1</a></p>]]></description>
	<dc:creator>Rahul Agarwal</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/17885/international-conference-on-bioinformatics-models-methods-and-algorithms</guid>
	<pubDate>Sun, 05 Oct 2014 11:42:52 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/17885/international-conference-on-bioinformatics-models-methods-and-algorithms</link>
	<title><![CDATA[International Conference on Bioinformatics Models, Methods and Algorithms]]></title>
	<description><![CDATA[<p><span>The purpose of the International Conference on Bioinformatics Models, Methods and Algorithms is to bring together researchers and practitioners interested in the application of computational systems and information technologies to the field of molecular biology, including for example the use of statistics and algorithms to understanding biological processes and systems, with a focus on new developments in genome bioinformatics and computational biology. Areas of interest for this community include sequence analysis, biostatistics, image analysis, scientific data management and data mining, machine learning, pattern recognition, computational evolutionary biology, computational genomics and other related fields.</span></p>
<p><span><span>Position Paper Submission Extension:</span><span>&nbsp;</span><span>October 9, 2014</span><span>&nbsp;</span><br><span>Regular Paper Authors Notification:</span><span>&nbsp;</span><span>November 3, 2014</span><span>&nbsp;</span><br><span>Position Paper Authors Notification:</span><span>&nbsp;</span><span>November 6, 2014</span><span>&nbsp;</span><br><span>Regular and Position Paper Camera Ready and Registration:</span><span>&nbsp;</span><span>November 17, 2014</span><span>&nbsp;</span></span></p><p>Address of the bookmark: <a href="http://www.bioinformatics.biostec.org/" rel="nofollow">http://www.bioinformatics.biostec.org/</a></p>]]></description>
	<dc:creator>Rahul Agarwal</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/42974/list-of-bioinformatics-packages-for-ngs-analysis</guid>
	<pubDate>Sat, 20 Mar 2021 00:28:51 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/42974/list-of-bioinformatics-packages-for-ngs-analysis</link>
	<title><![CDATA[List of bioinformatics packages for NGS analysis !]]></title>
	<description><![CDATA[<p>Package suites gather software packages and installation tools for specific languages or platforms. We have some for bioinformatics software.</p><ul>
<li><a href="https://github.com/Bioconductor">Bioconductor</a>&nbsp;&ndash; A plethora of tools for analysis and comprehension of high-throughput genomic data, including 1500+ software packages. [&nbsp;<a href="https://link.springer.com/article/10.1186/gb-2004-5-10-r80">paper-2004</a>&nbsp;|&nbsp;<a href="https://www.bioconductor.org/">web</a>&nbsp;]</li>
<li><a href="https://github.com/biopython/biopython">Biopython</a>&nbsp;&ndash; Freely available tools for biological computing in Python, with included cookbook, packaging and thorough documentation. Part of the&nbsp;<a href="http://open-bio.org/">Open Bioinformatics Foundation</a>. Contains the very useful&nbsp;<a href="https://biopython.org/DIST/docs/api/Bio.Entrez-module.html">Entrez</a>&nbsp;package for API access to the NCBI databases. [&nbsp;<a href="https://pubmed.ncbi.nlm.nih.gov/19304878">paper-2009</a>&nbsp;|&nbsp;<a href="https://biopython.org/">web</a>&nbsp;]</li>
<li><a href="https://github.com/bioconda">Bioconda</a>&nbsp;&ndash; A channel for the&nbsp;<a href="http://conda.pydata.org/docs/intro.html">conda package manager</a>&nbsp;specializing in bioinformatics software. Includes a repository with 3000+ ready-to-install (with&nbsp;<code>conda install</code>) bioinformatics packages. [&nbsp;<a href="https://pubmed.ncbi.nlm.nih.gov/29967506">paper-2018</a>&nbsp;|&nbsp;<a href="https://bioconda.github.io/">web</a>&nbsp;]</li>
<li><a href="https://github.com/BioJulia">BioJulia</a>&nbsp;&ndash; Bioinformatics and computational biology infastructure for the Julia programming language. [&nbsp;<a href="https://biojulia.net/">web</a>&nbsp;]</li>
<li><a href="https://github.com/rust-bio/rust-bio">Rust-Bio</a>&nbsp;&ndash; Rust implementations of algorithms and data structures useful for bioinformatics. [&nbsp;<a href="http://bioinformatics.oxfordjournals.org/content/early/2015/10/06/bioinformatics.btv573.short?rss=1">paper-2016</a>&nbsp;]</li>
<li><a href="https://github.com/seqan/seqan3">SeqAn</a>&nbsp;&ndash; The modern C++ library for sequence analysis.</li>
</ul>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/23121/senior-sas-programmer-urgent-role-permanant-welwyn-garden-city-uk</guid>
  <pubDate>Fri, 03 Jul 2015 08:14:23 -0500</pubDate>
  <link></link>
  <title><![CDATA[Senior SAS Programmer - URGENT ROLE - Permanant - Welwyn Garden City - UK]]></title>
  <description><![CDATA[
<p>SAS Programmer URGENTLY required !! My client is looking for an experienced Senior SAS Programmer, to join their bubbly dynamic team in Welwyn Garden City. You must have experience within SAS and/or R programming language. I am looking for someone with a background within either Life Sciences, Statistics, Computer Science, Bioinformatics etc. I am looking for someone with leadership qualities, you must have excellent analyst skills. Please call Dareen Evans on 01772 278050 or email your cv to dareen.evans@itworkshealth.co.uk</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/34552/edit-distance-application-in-bioinformatics</guid>
	<pubDate>Thu, 07 Dec 2017 08:46:51 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/34552/edit-distance-application-in-bioinformatics</link>
	<title><![CDATA[Edit distance application in bioinformatics !]]></title>
	<description><![CDATA[<p>There are other popular measures of&nbsp;<a href="https://en.wikipedia.org/wiki/Edit_distance" title="Edit distance">edit distance</a>, which are calculated using a different set of allowable edit operations. For instance,</p><ul>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Damerau%E2%80%93Levenshtein_distance" title="Damerau&ndash;Levenshtein distance">Damerau&ndash;Levenshtein distance</a>&nbsp;allows insertion, deletion, substitution, and the&nbsp;<a href="https://en.wikipedia.org/wiki/Transposition_(mathematics)" title="Transposition (mathematics)">transposition</a>&nbsp;of two adjacent characters;</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Longest_common_subsequence_problem" title="Longest common subsequence problem">longest common subsequence</a>&nbsp;(LCS) distance allows only insertion and deletion, not substitution;</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Hamming_distance" title="Hamming distance">Hamming distance</a>&nbsp;allows only substitution, hence, it only applies to strings of the same length.</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Jaro_distance" title="Jaro distance">Jaro distance</a>&nbsp;allows only&nbsp;<a href="https://en.wikipedia.org/wiki/Transposition_(mathematics)" title="Transposition (mathematics)">transposition</a>.</li>
</ul><p>&nbsp;</p><pre><span>use</span> Text<span>::</span>Levenshtein <span>qw</span><span>(</span>distance<span>);</span>

 <span>print</span> <span>distance</span><span>(</span><span>"foo"</span><span>,</span><span>"four"</span><span>);</span>
 <span># prints "2"</span>

 <span>my</span> <span>@words</span>     <span>=</span> <span>qw</span><span>/ four foo bar /</span><span>;</span>
 <span>my</span> <span>@distances</span> <span>=</span> <span>distance</span><span>(</span><span>"foo"</span><span>,</span><span>@words</span><span>);</span>

 <span>print</span> <span>"@distances"</span><span>;</span>
 <span># prints "2 0 3"</span><br /><br /><br /></pre><pre><span>use</span> Algorithm<span>::</span>LCSS <span>qw</span><span>(</span> LCSS CSS CSS_Sorted <span>);</span>
    <span>my</span> <span>$lcss_ary_ref</span> <span>=</span> <span>LCSS</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>  <span># ref to array</span>
    <span>my</span> <span>$lcss_string</span>  <span>=</span> <span>LCSS</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>    <span># string</span>
    <span>my</span> <span>$css_ary_ref</span> <span>=</span> <span>CSS</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>    <span># ref to array of arrays</span>
    <span>my</span> <span>$css_str_ref</span> <span>=</span> <span>CSS</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>      <span># ref to array of strings</span>
    <span>my</span> <span>$css_ary_ref</span> <span>=</span> <span>CSS_Sorted</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>  <span># ref to array of arrays</span>
    <span>my</span> <span>$css_str_ref</span> <span>=</span> <span>CSS_Sorted</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>    <span># ref to array of strings<br /><br /><br /><br /></span></pre><p>There are many different modules on CPAN for calculating the edit distance between two strings. Here's just a selection.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshteinXS">Text::LevenshteinXS</a>&nbsp;and&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3AXS">Text::Levenshtein::XS</a>&nbsp;are both versions of the Levenshtein algorithm that require a C compiler, but will be a lot faster than this module.</p><p>The Damerau-Levenshtein edit distance is like the Levenshtein distance, but in addition to insertion, deletion and substitution, it also considers the transposition of two adjacent characters to be a single edit. The module&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3ADamerau">Text::Levenshtein::Damerau</a>&nbsp;defaults to using a pure perl implementation, but if you've installed&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3ADamerau%3A%3AXS">Text::Levenshtein::Damerau::XS</a>&nbsp;then it will be a lot quicker.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3AWagnerFischer">Text::WagnerFischer</a>&nbsp;is an implementation of the Wagner-Fischer edit distance, which is similar to the Levenshtein, but applies different weights to each edit type.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ABrew">Text::Brew</a>&nbsp;is an implementation of the Brew edit distance, which is another algorithm based on edit weights.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3AFuzzy">Text::Fuzzy</a>&nbsp;provides a number of operations for partial or fuzzy matching of text based on edit distance.&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3AFuzzy%3A%3APP">Text::Fuzzy::PP</a>&nbsp;is a pure perl implementation of the same interface.</p><p><a href="http://search.cpan.org/perldoc?String%3A%3ASimilarity">String::Similarity</a>&nbsp;takes two strings and returns a value between 0 (meaning entirely different) and 1 (meaning identical). Apparently based on edit distance.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ADice">Text::Dice</a>&nbsp;calculates&nbsp;<a href="https://en.wikipedia.org/wiki/S%C3%B8rensen%E2%80%93Dice_coefficient">Dice's coefficient</a>&nbsp;for two strings. This formula was originally developed to measure the similarity of two different populations in ecological research.</p><pre><span>&nbsp;</span></pre>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/8265/list-of-generic-simulation-softwaretoolsresource-with-brief-description-and-homepage</guid>
	<pubDate>Mon, 10 Feb 2014 05:57:29 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/8265/list-of-generic-simulation-softwaretoolsresource-with-brief-description-and-homepage</link>
	<title><![CDATA[List of generic simulation software/tools/resource with brief description and homepage !!!]]></title>
	<description><![CDATA[<p>List of generic simulation software/tools/resource with brief description and homepage</p><p><img src="http://www.evolution-of-life.com/fileadmin/images/carousel/genetic.PNG" alt="image" style="border: 0px;"></p><p>ALF <br />A Simulation Framework for Genome Evolution <br />http://www.cbrg.ethz.ch/alf<br /><br />Bayesian Serial SimCoal <br />Bayesian Serial SimCoal, (BayeSSC) is a modification of SIMCOAL 1.0, a program written by Laurent Excoffier, John Novembre, and Stefan Schneider. <br />http://www.stanford.edu/group/hadlylab/ssc/index.html<br /><br />BEERS <br />BEERS was designed to benchmark RNA-Seq alignment algorithms and also algorithms that aim to reconstruct different isoforms and alternate splicing from RNA-Seq data <br />http://cbil.upenn.edu/beers/<br /><br />BOTTLENECK <br />Bottleneck is a program for detecting recent effective population size reductions from allele data frequencies <br />http://www.ensam.inra.fr/urlb/bottleneck/bottleneck.html<br /><br />BottleSim <br />BottleSim is a computer simulation program for simulating the process of population bottlenecks <br />http://chkuo.name/software/bottlesim.html<br /><br />CASS <br />Protein Sequence Simulation <br />http://www.wyomingbioinformatics.org/liberlesgroup/cass/<br /><br />CDPOP <br />CDPOP is a landscape genetics tool for simulating the emergence of spatial genetic structure in populations resulting from specified landscape processes governing organism movement behavior. <br />http://cel.dbs.umt.edu/cdpop<br /><br />CoalFace <br />CoalFace is a simulation of the coalescent process with the visual display of gene genealogies. <br />http://web.up.ac.za/default.asp?ipkcategoryid=3283<br /><br />CoaSim <br />CoaSim is a tool for simulating the coalescent process with recombination and geneconversion under various demographic models. <br />http://users-birc.au.dk/mailund/coasim/index.html<br /><br />cosi <br />The cosi package is written in C and is available as a tar file. <br />http://www.broadinstitute.org/~sfs/cosi/<br /><br />CS-PSeq-Gen <br />A program to simulate the evolution of protein sequences under the constraints of the information of a particular reconstructed phylogeny <br />http://bioserv.rpbs.univ-paris-diderot.fr/software/cs-pseq-gen.html<br /><br />DAWG <br />An application designed to simulate the evolution of recombinant DNA sequences in continuous time <br />http://scit.us/projects/dawg<br /><br />Easypop <br />EASYPOP is an individual based model intended to simulate datasets under a very broad range of conditions <br />http://www.unil.ch/dee/page36926_fr.html<br /><br />EggLib <br />EggLib is a C++/Python library and program package for evolutionary genetics and genomics. <br />http://egglib.sourceforge.net/<br /><br />EvolSimulator <br />A simulation test bed for hypotheses of genome evolution <br />http://acb.qfab.org/acb/evolsim/<br /><br />EvolveAGene <br />A realistic coding sequence simulation program that separates mutation from selection and allows the user to set selection conditions <br />http://bellinghamresearchinstitute.com/software/index.html<br /><br />fastsimcoal <br />A continuous-&not;‐time coalescent simulator of genomic diversity under arbitrarily complex evolutionary scenarios <br />http://cmpg.unibe.ch/software/fastsimcoal/<br /><br />FastSLINK <br />Simulation of Marker and Phenotype Data in Pedigrees <br />http://watson.hgen.pitt.edu/<br /><br />FFPopSim <br />C++/Python library for population genetics. <br />http://webdav.tuebingen.mpg.de/ffpopsim/<br /><br />FLUX SIMULATOR <br />The Flux Simulator aims at providing a deterministic in silico reproduction of the experimental pipelines for RNA-Seq, employing a minimal set of parameters. <br />http://flux.sammeth.net/simulator.html<br /><br />ForSim <br />ForSim: A Forward Evolutionary Computer Simulation <br />http://www.anthro.psu.edu/weiss_lab/research.shtml<br /><br />ForwSim <br />The program given below is based on the algorithm described in Padhukasahasram et al. 2008 to simulate genetic drift in a standard Wright-Fisher process. <br />http://badri-populationgeneticsimulators.blogspot.com/<br /><br />FPG <br />Forward Population Genetic simulation <br />http://genfaculty.rutgers.edu/hey/software#fpg<br /><br />FREGENE <br />FREGENE is a C++ program that simulates sequence-like data over large genomic regions in large diploid populations. <br />http://www.ebi.ac.uk/projects/bargen/download/fregen/documentation_html.html<br /><br />GAMETES <br />Genetic Architecture Model Emulator for Testing and Evaluating Software: Simulates complex SNP models with pure, strict epistatic interactions with n-loci. <br />http://sourceforge.net/projects/gametes/?source=navbar<br /><br />GASP <br />Genometric Analysis Simulation Program. A software tool for testing and investigating methods in statistical genetics by generating samples of family data based on user specified models. <br />http://research.nhgri.nih.gov/gasp/<br /><br />GemSIM <br />Next generation sequencing read simulator <br />http://sourceforge.net/projects/gemsim/<br /><br />GeneArtisan <br />Simulation of Markers in Case-Control Study Designs <br />http://www.rannala.org/?page_id=241<br /><br />GENOME <br />A rapid coalescent-based whole genome simulator <br />http://www.sph.umich.edu/csg/liang/genome/<br /><br />GenomePop2 <br />GenomePop2 is a specialization of the program GenomePop just to manage SNPs under more flexible and useful settings. If you need models with more than 2 alleles please use the GenomePop program version. <br />http://webs.uvigo.es/acraaj/genomepop2.htm<br /><br />GenomeSimla <br />GenomeSIMLA is currently under development- however, we have a beta release that we are asking to be tested <br />http://chgr.mc.vanderbilt.edu/genomesimla/<br /><br />GENS2 <br />Simulates interactions among two genetic and one environmental factor and also allows for epistatic interactions. <br />https://sourceforge.net/projects/gensim/<br /><br />GWAsimulator <br />A rapid whole genome simulation program <br />http://biostat.mc.vanderbilt.edu/wiki/main/gwasimulator<br /><br />HAP-SAMPLE <br />An association simulator for candidate regions or genome scans <br />http://www.hapsample.org/<br /><br />HAPGEN <br />A simulator for the simulation of case control datasets at SNP markers <br />https://mathgen.stats.ox.ac.uk/genetics_software/hapgen/hapgen2.html<br /><br />HapSim <br />A simulation tool for generating haplotype data with pre-specified allele frequencies and LD coefficients <br />http://cran.r-project.org/web/packages/hapsim/index.html<br /><br />HAPSIMU <br />A program that simulates heterogeneous populations with various known and controllable structures under the continuous migration model or the discrete model <br />http://l.web.umkc.edu/liujian/<br /><br />IBDsim <br />IBDSim is a computer package for the simulation of genotypic data under general isolation by distance models. <br />http://raphael.leblois.free.fr/<br /><br />indel-Seq-Gen <br />A biological sequence simulation program that simulates highly divergent DNA sequences and protein superfamilies <br />http://bioinfolab.unl.edu/~cstrope/isg/<br /><br />Indelible <br />A powerful and flexible simulator of biological evolution <br />http://abacus.gene.ucl.ac.uk/software/indelible/<br /><br />invertFREGENE <br />InvertFREGENE is a forward-in-time simulator of inversions in population genetic data <br />http://www.ebi.ac.uk/projects/bargen/<br /><br />kernalPop <br />A spatially explicit population genetic simulation engine <br />http://cran.r-project.org/src/contrib/archive/kernelpop/<br /><br />MaCS <br />Markovian Coalescent Simulator <br />http://www-hsc.usc.edu/~garykche/<br /><br />Mason <br />A package for the simulation of nucleotide data. <br />http://www.seqan.de/projects/mason/<br /><br />mbs <br />modifying Hudson's ms software to generate samples of DNA sequences with a biallelic site under selection <br />http://www.sendou.soken.ac.jp/esb/innan/innanlab/software.html<br /><br />Mendel's Accountant <br />Mendel's Accountant (MENDEL) is an advanced numerical simulation program for modeling genetic change over time and was developed collaboratively by Sanford, Baumgardner, Brewer, Gibson and ReMine <br />http://mendelsaccount.sourceforge.net/<br /><br />MetaSim <br />A tool to generate collections of synthetic reads that reflect the diverse taxonomical composition of typical metagenome data sets <br />http://ab.inf.uni-tuebingen.de/software/metasim/<br /><br />mlcoalsim <br />Multilocus Coalescent Simulations <br />http://code.google.com/p/mlcoalsim-v1/<br /><br />ms <br />The purpose of this program is to allow one to investigate the statistical properties of such samples, to evaluate estimators or statistical tests, and generally to aid in the interpretation of polymorphism data sets. <br />http://home.uchicago.edu/~rhudson1/source/mksamples.html<br /><br />msHOT <br />The purpose of this program is to allow one to investigate the statistical properties of such samples, to evaluate estimators or statistical tests, and generally to aid in the interpretation of polymorphism data sets. <br />http://home.uchicago.edu/~rhudson1/<br /><br />msms <br />A coalescent Simlation tool with selection. <br />http://www.mabs.at/ewing/msms/index.shtml<br /><br />MySSP <br />A program for the simulation of DNA sequence evolution across a phylogenetic tree <br />http://www.rosenberglab.net/software.php<br /><br />Nemo <br />A forward-time, individual-based, genetically explicit, and stochastic simulation program designed to study the evolution of genetic markers, life history traits, and phenotypic traits in a flexible (meta-)population framework. <br />http://nemo2.sourceforge.net/<br /><br />NetRecodon <br />Coalescent simulation of coding DNA sequences with recombination (inter and intracodon), migration and demography <br />http://code.google.com/p/netrecodon/<br /><br />PEDAGOG <br />Software for simulating eco-evolutionary population dynamics <br />https://bcrc.bio.umass.edu/pedigreesoftware/node/5<br /><br />phenosim <br />A tool to add phenotypes to simulated genotypes <br />http://evoplant.uni-hohenheim.de/doku.php?id=software:software<br /><br />PhyloSim <br />An R package for the Monte Carlo simulation of sequence evolution <br />http://bit.ly/rlsim-git<br /><br />pIRS <br />Profile-based Illumina pair-end reads simulator <br />https://code.google.com/p/pirs/<br /><br />ProteinEvolver <br />Simulation of protein evolution along phylogenies under structure-based substitution models <br />http://code.google.com/p/proteinevolver/<br /><br />QMSim <br />QTL and Marker Simulator <br />http://www.aps.uoguelph.ca/~msargol/qmsim/<br /><br />quantiNEMO <br />An individual-based program for the analysis of quantitative traits with explicit genetic architecture potentially under selection in a structured population <br />http://www2.unil.ch/popgen/softwares/quantinemo/<br /><br />RECOAL <br />Simulates new haplotype data from a reference population of haplotypes. <br />ftp://popgen.usc.edu/<br /><br />Recodon <br />Coalescent simulation of coding DNA sequences with recombination, migration and demography <br />http://code.google.com/p/recodon/<br /><br />rlsim <br />A package for simulating RNA-seq library preparation with parameter estimation <br />http://bit.ly/rlsim-git<br /><br />Rmetasim <br />Rmetasim is a front-end for the metasim engine that is implemented as a package that runs in the statistical computing environment R <br />http://linum.cofc.edu/software.html#metasim<br /><br />RNA Seq Simulator <br />RSS takes SAM alignment files from RNA-Seq data and simulates over dispersed, multiple replica, differential, non-stranded RNA-Seq datasets. <br />http://useq.sourceforge.net/cmdlnmenus.html#rnaseqsimulator<br /><br />Rose <br />Random model of sequence evolution <br />http://bibiserv.techfak.uni-bielefeld.de/rose/<br /><br />SelSim <br />SelSim is a program for Monte Carlo simulation of DNA polymorphism data for a recom- bining region within which a single bi-allelic site has experienced natural selection <br />http://www.well.ox.ac.uk/~spencer/selsim/<br /><br />Seq-Gen <br />An application for the Monte Carlo simulation of molecular sequence evolution along phylogenetic trees. <br />http://tree.bio.ed.ac.uk/software/seqgen/<br /><br />SEQPower <br />Statistical power analysis for sequence-based association studies <br />http://bioinformatics.org/spower/<br /><br />SeqSIMLA <br />SeqSIMLA can simulate sequence data with user-specified disease and quantitative trait models. Family or unrelated case-control data can be simulated. <br />http://seqsimla.sourceforge.net/<br /><br />Serial NetEvolve <br />A flexible utility for generating serially-sampled sequences along a tree or recombinant network <br />http://biorg.cis.fiu.edu/sne/<br /><br />SFS_CODE <br />SFS_CODE can perform forward population genetic simulations under a general Wright-Fisher model with arbitrary migration, demographic, selective, and mutational effects. <br />http://sfscode.sourceforge.net/sfs_code/index/index.html<br /><br />SIBSIM <br />Quantitative phenotype simulation in extended pedigrees <br />http://sourceforge.net/projects/sibsim/<br /><br />SIMCOAL2 <br />A coalescent program for the simulation of complex recombination patterns over large genomic regions under various demographic models <br />http://cmpg.unibe.ch/software/simcoal2/<br /><br />SimCopy <br />An R package simulating the evolution of copy number profiles along a tree. <br />http://bit.ly/simcopy<br /><br />SIMLA <br />SIMLA is a SIMuLAtion program that generates data sets of families for use in Linkage and Association studies. <br />http://www.chg.duke.edu/research/simla.html<br /><br />SimPed <br />A Simulation Program to Generate Haplotype and Genotype Data for Pedigree Structures <br />http://www.hgsc.bcm.tmc.edu/content/simped<br /><br />Simprot <br />A program to simulate protein evolution by substitution, insertion and deletion <br />http://www.uhnresearch.ca/labs/tillier/software.htm#3<br /><br />SimRare <br />Rare variant simulation and analysis tool <br />http://code.google.com/p/simrare/<br /><br />simuGWAS <br />A forward-time simulator that simulates realistic samples for genome-wide association studies. <br />http://simupop.sourceforge.net/cookbook/simucomplexdisease<br /><br />simuPOP <br />simuPOP is a general-purpose individual-based forward-time population genetics simulation environment. <br />http://simupop.sourceforge.net/<br /><br />SISSI <br />A software tool to generate data of related sequences along a given phylogeny, taking into account user defined system of neighbourhoods and instantaneous rate matrices. <br />http://www.cibiv.at/software/sissi/<br /><br />SNPsim <br />Coalescent simulation of hotspot recombination <br />http://code.google.com/p/phylosoftware/<br /><br />SPIP <br />SPIP simulates the transmission of genes from parents to offspring in a population having demographic structure defined by the user <br />http://swfsc.noaa.gov/textblock.aspx?division=fed&amp;id=3434<br /><br />Splatche <br />Spatial and Temporal Coalescences in Heterogeneous Environment <br />http://www.splatche.com/<br /><br />srv <br />Simulator of Rare Varaints (srv) is a simulator for the simulation of the introduction and evolution of (rare) genetic variants. <br />http://simupop.sourceforge.net/cookbook/simurarevariants<br /><br />SUP <br />SLINK/FastSLINK utility program <br />http://mlemire.freeshell.org/software.html<br /><br />TreesimJ <br />A flexible, forward-time population genetic simulator <br />http://code.google.com/p/treesimj/<br /><br />Vortex <br />VORTEX is an individual-based simulation model for population viability analysis (PVA). <br />http://www.vortex9.org/vortex.html<br /><br />References:</p><p>Image www.evolution-of-life.com</p><p>www.cancer.gov</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>

</channel>
</rss>