https://bioinformaticsonline.com/snippets/view/28429/blast-script-to-index-and-extract-sequence? https://bioinformaticsonline.com/snippets/view/28429/blast-script-to-index-and-extract-sequence Thu, 14 Jul 2016 09:52:17 -0500 https://bioinformaticsonline.com/snippets/view/28429/blast-script-to-index-and-extract-sequence # look at the file $ head EC4115.fa >NC_011353.1 Escherichia coli O157:H7 str. EC4115 chromosome, complete genome. AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTCTC TGACAGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGG TCACTAAATACTTTAACCAATATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTAC # generate the blast database $ makeblastdb -dbtype nucl -out EC -in EC4115.fa -parse_seqids # retreive an entry by id $ blastdbcmd -db EC -entry 'NC_011353.1' | head >lcl|NC_011353.1 Escherichia coli O157:H7 str. EC4115 chromosome, complete genome AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTCTCTGACAGCAGCTTCTGAACTG GTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATAGCGCACAGAC .... # query the blast database by id and coordinates $ blastdbcmd -db EC -range 100-105 -entry 'NC_011353.1' >lcl|NC_011353.1:100-105 Escherichia coli O157:H7 str. EC4115 chromosome, complete genome TTAAAA]]> Shruti Paniwala