BOL: Installing Porechop on Ubuntu !

Installing Porechop on Ubuntu !

Jit — Mon, 30 Jul 2018 10:05:45 -0500

➜  Tools git:(master) ✗ git clone https://github.com/rrwick/Porechop.git
Cloning into 'Porechop'...
remote: Counting objects: 1579, done.
remote: Total 1579 (delta 0), reused 0 (delta 0), pack-reused 1579
Receiving objects: 100% (1579/1579), 3.38 MiB | 1.62 MiB/s, done.
Resolving deltas: 100% (869/869), done.
Checking connectivity... done.
➜  Tools git:(master) ✗ cd Porechop    
➜  Porechop git:(master) python3 setup.py install
running install
running build
running build_py
creating build
creating build/lib
creating build/lib/porechop
copying porechop/version.py -> build/lib/porechop
copying porechop/nanopore_read.py -> build/lib/porechop
copying porechop/cpp_function_wrappers.py -> build/lib/porechop
copying porechop/porechop.py -> build/lib/porechop
copying porechop/misc.py -> build/lib/porechop
copying porechop/adapters.py -> build/lib/porechop
copying porechop/__init__.py -> build/lib/porechop
Cleaning previous compilation: make clean
rm -f porechop/src/adapter_align.o porechop/src/alignment.o
Compiling Porechop: make -j 8
g++ -std=c++14 -Iporechop/include -fPIC -O3 -D NDEBUG -Wall -Wextra -pedantic -mtune=native -c -o porechop/src/adapter_align.o porechop/src/adapter_align.cpp
g++ -std=c++14 -Iporechop/include -fPIC -O3 -D NDEBUG -Wall -Wextra -pedantic -mtune=native -c -o porechop/src/alignment.o porechop/src/alignment.cpp
g++ -std=c++14 -Iporechop/include -fPIC -O3 -D NDEBUG -Wall -Wextra -pedantic -mtune=native -shared -Wl,-soname,porechop/cpp_functions.so -o porechop/cpp_functions.so porechop/src/adapter_align.o porechop/src/alignment.o
running install_lib
creating /home/urbe/anaconda3/lib/python3.6/site-packages/porechop
copying build/lib/porechop/version.py -> /home/urbe/anaconda3/lib/python3.6/site-packages/porechop
copying build/lib/porechop/nanopore_read.py -> /home/urbe/anaconda3/lib/python3.6/site-packages/porechop
copying build/lib/porechop/cpp_function_wrappers.py -> /home/urbe/anaconda3/lib/python3.6/site-packages/porechop
copying build/lib/porechop/porechop.py -> /home/urbe/anaconda3/lib/python3.6/site-packages/porechop
copying build/lib/porechop/misc.py -> /home/urbe/anaconda3/lib/python3.6/site-packages/porechop
copying build/lib/porechop/adapters.py -> /home/urbe/anaconda3/lib/python3.6/site-packages/porechop
copying build/lib/porechop/__init__.py -> /home/urbe/anaconda3/lib/python3.6/site-packages/porechop
byte-compiling /home/urbe/anaconda3/lib/python3.6/site-packages/porechop/version.py to version.cpython-36.pyc
byte-compiling /home/urbe/anaconda3/lib/python3.6/site-packages/porechop/nanopore_read.py to nanopore_read.cpython-36.pyc
byte-compiling /home/urbe/anaconda3/lib/python3.6/site-packages/porechop/cpp_function_wrappers.py to cpp_function_wrappers.cpython-36.pyc
byte-compiling /home/urbe/anaconda3/lib/python3.6/site-packages/porechop/porechop.py to porechop.cpython-36.pyc
byte-compiling /home/urbe/anaconda3/lib/python3.6/site-packages/porechop/misc.py to misc.cpython-36.pyc
byte-compiling /home/urbe/anaconda3/lib/python3.6/site-packages/porechop/adapters.py to adapters.cpython-36.pyc
byte-compiling /home/urbe/anaconda3/lib/python3.6/site-packages/porechop/__init__.py to __init__.cpython-36.pyc
running install_egg_info
running egg_info
creating porechop.egg-info
writing porechop.egg-info/PKG-INFO
writing dependency_links to porechop.egg-info/dependency_links.txt
writing entry points to porechop.egg-info/entry_points.txt
writing top-level names to porechop.egg-info/top_level.txt
writing manifest file 'porechop.egg-info/SOURCES.txt'
reading manifest file 'porechop.egg-info/SOURCES.txt'
reading manifest template 'MANIFEST.in'
writing manifest file 'porechop.egg-info/SOURCES.txt'
Copying porechop.egg-info to /home/urbe/anaconda3/lib/python3.6/site-packages/porechop-0.2.3-py3.6.egg-info
running install_scripts
Installing porechop script to /home/urbe/anaconda3/bin
➜  Porechop git:(master) porechop -h
usage: porechop -i INPUT [-o OUTPUT]
                [--format {auto,fasta,fastq,fasta.gz,fastq.gz}] [-v VERBOSITY]
                [-t THREADS] [-b BARCODE_DIR]
                [--barcode_threshold BARCODE_THRESHOLD]
                [--barcode_diff BARCODE_DIFF] [--require_two_barcodes]
                [--untrimmed] [--discard_unassigned]
                [--adapter_threshold ADAPTER_THRESHOLD]
                [--check_reads CHECK_READS] [--scoring_scheme SCORING_SCHEME]
                [--end_size END_SIZE] [--min_trim_size MIN_TRIM_SIZE]
                [--extra_end_trim EXTRA_END_TRIM]
                [--end_threshold END_THRESHOLD] [--no_split]
                [--discard_middle] [--middle_threshold MIDDLE_THRESHOLD]
                [--extra_middle_trim_good_side EXTRA_MIDDLE_TRIM_GOOD_SIDE]
                [--extra_middle_trim_bad_side EXTRA_MIDDLE_TRIM_BAD_SIDE]
                [--min_split_read_size MIN_SPLIT_READ_SIZE] [-h] [--version]

Porechop: a tool for finding adapters in Oxford Nanopore reads, trimming them
from the ends and splitting reads with internal adapters

Main options:
  -i INPUT, --input INPUT
                          FASTA/FASTQ of input reads or a directory which will
                          be recursively searched for FASTQ files (required)
  -o OUTPUT, --output OUTPUT
                          Filename for FASTA or FASTQ of trimmed reads (if not
                          set, trimmed reads will be printed to stdout)
  --format {auto,fasta,fastq,fasta.gz,fastq.gz}
                          Output format for the reads - if auto, the format
                          will be chosen based on the output filename or the
                          input read format (default: auto)
  -v VERBOSITY, --verbosity VERBOSITY
                          Level of progress information: 0 = none, 1 = some, 2
                          = lots, 3 = full - output will go to stdout if reads
                          are saved to a file and stderr if reads are printed
                          to stdout (default: 1)
  -t THREADS, --threads THREADS
                          Number of threads to use for adapter alignment
                          (default: 16)

Barcode binning settings:
  Control the binning of reads based on barcodes (i.e. barcode
  demultiplexing)

  -b BARCODE_DIR, --barcode_dir BARCODE_DIR
                          Reads will be binned based on their barcode and
                          saved to separate files in this directory
                          (incompatible with --output)
  --barcode_threshold BARCODE_THRESHOLD
                          A read must have at least this percent identity to a
                          barcode to be binned (default: 75.0)
  --barcode_diff BARCODE_DIFF
                          If the difference between a read's best barcode
                          identity and its second-best barcode identity is
                          less than this value, it will not be put in a
                          barcode bin (to exclude cases which are too close to
                          call) (default: 5.0)
  --require_two_barcodes  Reads will only be put in barcode bins if they have
                          a strong match for the barcode on both their start
                          and end (default: a read can be binned with a match
                          at its start or end)
  --untrimmed             Bin reads but do not trim them (default: trim the
                          reads)
  --discard_unassigned    Discard unassigned reads (instead of creating a
                          "none" bin) (default: False)

Adapter search settings:
  Control how the program determines which adapter sets are present

  --adapter_threshold ADAPTER_THRESHOLD
                          An adapter set has to have at least this percent
                          identity to be labelled as present and trimmed off
                          (0 to 100) (default: 90.0)
  --check_reads CHECK_READS
                          This many reads will be aligned to all possible
                          adapters to determine which adapter sets are present
                          (default: 10000)
  --scoring_scheme SCORING_SCHEME
                          Comma-delimited string of alignment scores: match,
                          mismatch, gap open, gap extend (default: 3,-6,-5,-2)

End adapter settings:
  Control the trimming of adapters from read ends

  --end_size END_SIZE     The number of base pairs at each end of the read
                          which will be searched for adapter sequences
                          (default: 150)
  --min_trim_size MIN_TRIM_SIZE
                          Adapter alignments smaller than this will be ignored
                          (default: 4)
  --extra_end_trim EXTRA_END_TRIM
                          This many additional bases will be removed next to
                          adapters found at the ends of reads (default: 2)
  --end_threshold END_THRESHOLD
                          Adapters at the ends of reads must have at least
                          this percent identity to be removed (0 to 100)
                          (default: 75.0)

Middle adapter settings:
  Control the splitting of read from middle adapters

  --no_split              Skip splitting reads based on middle adapters
                          (default: split reads when an adapter is found in
                          the middle)
  --discard_middle        Reads with middle adapters will be discarded
                          (default: reads with middle adapters are split)
                          (required for reads to be used with Nanopolish, this
                          option is on by default when outputting reads into
                          barcode bins)
  --middle_threshold MIDDLE_THRESHOLD
                          Adapters in the middle of reads must have at least
                          this percent identity to be found (0 to 100)
                          (default: 85.0)
  --extra_middle_trim_good_side EXTRA_MIDDLE_TRIM_GOOD_SIDE
                          This many additional bases will be removed next to
                          middle adapters on their "good" side (default: 10)
  --extra_middle_trim_bad_side EXTRA_MIDDLE_TRIM_BAD_SIDE
                          This many additional bases will be removed next to
                          middle adapters on their "bad" side (default: 100)
  --min_split_read_size MIN_SPLIT_READ_SIZE
                          Post-split read pieces smaller than this many base
                          pairs will not be outputted (default: 1000)

Help:
  -h, --help              Show this help message and exit
  --version               Show program's version number and exit

Comment by Jit

Jit — Mon, 30 Jul 2018 10:25:52 -0500

➜ MyPassport porechop -i /media/urbe/MyDDrive/ONTdata/allONT/allONT.fasta -t 40 > ONT_choppedNcorrected.fa

Loading reads
/media/urbe/MyDDrive/ONTdata/allONT/allONT.fasta
1,634,477 reads loaded

Looking for known adapter sets
10,000 / 10,000 (100.0%)
Best
read Best
start read end
Set %ID %ID
SQK-NSK007 96.6 81.8
Rapid 66.1 0.0
SQK-MAP006 80.0 82.6
SQK-MAP006 Short 76.9 76.0
PCR adapters 1 82.6 78.3
PCR tail 1 76.7 75.9
PCR tail 2 79.3 77.4
1D^2 part 1 74.1 76.7
1D^2 part 2 91.2 80.6
Barcode 1 (reverse) 76.0 78.6
Barcode 2 (reverse) 79.2 80.0
Barcode 3 (reverse) 80.0 75.0
Barcode 4 (reverse) 80.0 77.8
Barcode 5 (reverse) 73.1 76.9
Barcode 6 (reverse) 76.0 76.9
Barcode 7 (reverse) 79.2 79.2
Barcode 8 (reverse) 81.5 76.0
Barcode 9 (reverse) 76.0 76.0
Barcode 10 (reverse) 76.0 78.6
Barcode 11 (reverse) 79.2 80.8
Barcode 12 (reverse) 80.0 83.3
Barcode 1 (forward) 83.3 80.0
Barcode 2 (forward) 80.0 80.0
Barcode 3 (forward) 76.9 76.0
Barcode 4 (forward) 80.8 76.9
Barcode 5 (forward) 75.0 75.0
Barcode 6 (forward) 76.9 76.9
Barcode 7 (forward) 80.0 79.2
Barcode 8 (forward) 76.9 76.9
Barcode 9 (forward) 80.0 76.9
Barcode 10 (forward) 77.8 79.2
Barcode 11 (forward) 76.9 80.0
Barcode 12 (forward) 79.2 79.2
Barcode 13 (forward) 76.9 80.0
Barcode 14 (forward) 76.0 74.1
Barcode 15 (forward) 73.1 75.0
Barcode 16 (forward) 76.0 79.2
Barcode 17 (forward) 76.0 75.0
Barcode 18 (forward) 76.9 78.6
Barcode 19 (forward) 78.6 80.8
Barcode 20 (forward) 80.0 79.2
Barcode 21 (forward) 79.2 80.0
Barcode 22 (forward) 79.2 80.0
Barcode 23 (forward) 75.0 75.0
Barcode 24 (forward) 80.8 76.0
Barcode 25 (forward) 76.9 77.8
Barcode 26 (forward) 80.0 77.8
Barcode 27 (forward) 76.0 76.9
Barcode 28 (forward) 80.0 77.8
Barcode 29 (forward) 76.0 76.0
Barcode 30 (forward) 80.0 76.9
Barcode 31 (forward) 79.2 77.8
Barcode 32 (forward) 76.0 79.2
Barcode 33 (forward) 76.9 76.0
Barcode 34 (forward) 76.0 79.2
Barcode 35 (forward) 76.0 75.0
Barcode 36 (forward) 76.0 76.0
Barcode 37 (forward) 80.0 80.0
Barcode 38 (forward) 76.0 80.8
Barcode 39 (forward) 74.1 76.0
Barcode 40 (forward) 79.2 76.0
Barcode 41 (forward) 76.0 77.8
Barcode 42 (forward) 76.0 80.0
Barcode 43 (forward) 76.9 79.2
Barcode 44 (forward) 76.0 75.0
Barcode 45 (forward) 76.0 76.9
Barcode 46 (forward) 79.2 76.0
Barcode 47 (forward) 76.0 75.0
Barcode 48 (forward) 79.2 76.0
Barcode 49 (forward) 80.8 78.6
Barcode 50 (forward) 75.0 76.9
Barcode 51 (forward) 76.0 76.0
Barcode 52 (forward) 76.9 79.2
Barcode 53 (forward) 76.0 76.9
Barcode 54 (forward) 76.9 80.0
Barcode 55 (forward) 79.2 77.8
Barcode 56 (forward) 80.0 76.0
Barcode 57 (forward) 75.0 76.0
Barcode 58 (forward) 75.0 75.0
Barcode 59 (forward) 76.9 79.2
Barcode 60 (forward) 75.0 76.9
Barcode 61 (forward) 73.1 76.0
Barcode 62 (forward) 76.9 76.0
Barcode 63 (forward) 76.0 77.8
Barcode 64 (forward) 81.5 79.2
Barcode 65 (forward) 76.0 76.9
Barcode 66 (forward) 76.0 76.9
Barcode 67 (forward) 76.9 76.9
Barcode 68 (forward) 79.2 79.2
Barcode 69 (forward) 76.9 76.9
Barcode 70 (forward) 76.9 76.0
Barcode 71 (forward) 77.8 76.0
Barcode 72 (forward) 80.0 76.0
Barcode 73 (forward) 79.2 80.0
Barcode 74 (forward) 77.8 76.9
Barcode 75 (forward) 79.2 76.0
Barcode 76 (forward) 80.0 79.2
Barcode 77 (forward) 76.0 76.0
Barcode 78 (forward) 80.0 80.8
Barcode 79 (forward) 76.9 80.0
Barcode 80 (forward) 76.9 76.9
Barcode 81 (forward) 77.8 80.0
Barcode 82 (forward) 77.8 75.0
Barcode 83 (forward) 77.8 80.0
Barcode 84 (forward) 75.0 75.0
Barcode 85 (forward) 76.9 76.9
Barcode 86 (forward) 76.0 76.0
Barcode 87 (forward) 76.0 76.9
Barcode 88 (forward) 80.8 76.0
Barcode 89 (forward) 79.2 80.0
Barcode 90 (forward) 75.0 74.1
Barcode 91 (forward) 73.1 74.1
Barcode 92 (forward) 75.0 76.9
Barcode 93 (forward) 76.0 80.0
Barcode 94 (forward) 75.0 76.0
Barcode 95 (forward) 80.0 80.8
Barcode 96 (forward) 79.2 76.0

Trimming adapters from read ends
SQK-NSK007_Y_Top: AATGTACTTCGTTCAGTTACGTATTGCT
SQK-NSK007_Y_Bottom: GCAATACGTAACTGAACGAAGT
1D2_part_2_start: CTTCGTTCAGTTACGTATTGCTGGCGTCTGCTT
1D2_part_2_end: CACCCAAGCAGACGCCAGCAATACGTAACT

1,634,477 / 1,634,477 (100.0%)

1,150,024 / 1,634,477 reads had adapters trimmed from their start (40,250,129 bp removed)
419,580 / 1,634,477 reads had adapters trimmed from their end (6,338,306 bp removed)

Splitting reads containing middle adapters
1,634,477 / 1,634,477 (100.0%)

1,202 / 1,634,477 reads were split based on middle adapters

Outputting trimmed reads to stdout
Done