https://bioinformaticsonline.com/snippets?offset=300 https://bioinformaticsonline.com/snippets/view/37802/perl-script-to-reverse-complement-a-dna-sequence Mon, 01 Oct 2018 08:44:56 -0500 https://bioinformaticsonline.com/snippets/view/37802/perl-script-to-reverse-complement-a-dna-sequence #!/usr/bin/perl -w $DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC'; print "Here is the starting DNA:\n\n"; print "$DNA\n\n"; $revcom = reverse $DNA; $revcom =~ s/A/T/g; $revcom =~ s/T/A/g; $revcom =~ s/G/C/g; $revcom =~ s/C/G/g; print "Here is the reverse complement DNA: WRONG:\n\n"; print "$revcom\n"; print "\nThat was a bad algorithm, and the reverse complement was wrong!\n"; print "Try again ... \n\n"; # Make a new copy of the DNA (see why we saved the original?) $revcom = reverse $DNA; # See the text for a discussion of tr/// $revcom =~ tr/ACGTacgt/TGCAtgca/; print "Here is the reverse complement DNA:\n\n"; print "$revcom\n"; print "\nThis time it worked!\n\n"; exit;]]> Neel https://bioinformaticsonline.com/snippets/view/37783/perl-script-to-split-fasta-sequence-overlaps Wed, 26 Sep 2018 05:51:21 -0500 https://bioinformaticsonline.com/snippets/view/37783/perl-script-to-split-fasta-sequence-overlaps #!/usr/bin/perl use strict; use warnings; my $len = 5000; my $over = 200; my $seq_id=$ARGV[0]; my $seqFile = $ARGV[1]; my $seq; open(my $fh, "<", "$seqFile") or die "Can't open < $seqFile: $!"; while (<$fh>) { chomp; if (m/^>/) { $seq_id = $_; } else { $seq .= $_; } } for (my $i = 1; $i <= length $seq; $i += ($len - $over)) { my $s = substr ($seq, $i - 1, $len); print "$seq_id.($i-", $i + (length $s) - 1, ")\n$s\n"; }]]> BioStar https://bioinformaticsonline.com/snippets/view/37757/generate-simulated-polyploid-genome Fri, 21 Sep 2018 09:00:47 -0500 https://bioinformaticsonline.com/snippets/view/37757/generate-simulated-polyploid-genome #Generate 3% divergence msbar -point 4 -count 16558 toy.fasta > toyheterozygous3percent.fasta #Cat both files cat toy.fasta toymutated3percent.fasta > toyheterozygous3percent.fasta #generated 50X of Illumina paired-end reads sim_reads --depth 50 toyheterozygous3percent.fasta > toyheterozygous3percentD50.fasta]]> Jit https://bioinformaticsonline.com/snippets/view/37740/generates-a-genome-coverage-plot-with-r Wed, 19 Sep 2018 02:44:42 -0500 https://bioinformaticsonline.com/snippets/view/37740/generates-a-genome-coverage-plot-with-r library(CoverageView) ##draw a coverage plot for a test case BAM file #get a BAM test file treatBAMfile<-system.file("extdata","treat.bam",package="CoverageView") #create the CoverageBamFile object trm<-CoverageBamFile(treatBAMfile) #draw the plot genome.covplot.depth(trm,outfile="test.png") #draw the plot setting the max_depth parameter (70X in this case) genome.covplot.depth(trm,outfile="test.png",max_depth=70) ##draw two overlapping coverage plots for two different test BAM files #get a first BAM test file treatBAMfile<-system.file("extdata","treat.bam",package="CoverageView") #create the CoverageBamFile object trm<-CoverageBamFile(treatBAMfile) #get a second BAM test file ctrlBAMfile<-system.file("extdata","ctrl.bam",package="CoverageView") #create the CoverageBamFile object ctl<-CoverageBamFile(ctrlBAMfile) #create a list with the two files input_d=list(trm,ctl) #draw the plot genome.covplot.depth(input_d,outfile="test.png")]]> Jit https://bioinformaticsonline.com/snippets/view/37690/install-older-version-of-r-packages Fri, 14 Sep 2018 07:43:46 -0500 https://bioinformaticsonline.com/snippets/view/37690/install-older-version-of-r-packages #Install older version of R Packages ! require(devtools) install_version("IdeoViz", version = "0.9.1", repos = "http://cran.us.r-project.org")]]> Jit https://bioinformaticsonline.com/snippets/view/37688/plot-vcf-with-r Fri, 14 Sep 2018 05:44:46 -0500 https://bioinformaticsonline.com/snippets/view/37688/plot-vcf-with-r library(vcfR) # Input the files. vcf <- read.vcfR("variant.vcf.gz", verbose = FALSE) dna <- ape::read.dna("000000F_0.fa", format = "fasta") #gff <- read.table(gff_file, sep="\t", quote="") # Create a chromR object. chrom <- create.chromR(name="Supercontig", vcf=vcf, seq=dna, verbose=TRUE) plot(chrom) chromoqc(chrom, dp.alpha=20)]]> Jit https://bioinformaticsonline.com/snippets/view/37682/perl-script-to-break-the-contigs-by-n Tue, 11 Sep 2018 15:31:55 -0500 https://bioinformaticsonline.com/snippets/view/37682/perl-script-to-break-the-contigs-by-n #!/usr/bin/perl -w use Bio::SeqIO; use strict; my $fasta = Bio::SeqIO->new( -file => "<$ARGV[0]", -format => 'fasta' ); my $minNlen = 5; my $out=Bio::SeqIO->new(-file=>">$ARGV[0].parts.fasta",-format=>'fasta'); open(SCAFF,">$ARGV[0].parts.scaff"); while ( my $seqobj = $fasta->next_seq() ) { #gets contig id my $contig = $seqobj->display_id(); #gets contig sequence my $seq = $seqobj->seq; my $lenseq=length $seq; $seq = uc $seq; #now all bases are in uppercase #Searches for NNNNN regions (scaffold breaks) #Hash nregions stores a hash from the contig id to the NNNNN regions found. #Each region is represented as a pair "$ini $end" indicating that start and #the end of the NNNNN region in the contig my @regions=(); my @bases=split //,$seq; push(@bases,"E"); #This extra position marks the end of the contig my $n=0; #Sorry for this loop, but its less memory expensive than regular expressions for (my $i=0;$i<=$#bases;$i++) { if ($bases[$i] eq 'N') { $n++; } else { if ($n>=$minNlen) { my $end=$i; my $ini=$end-$n+1; push(@regions,"$ini $end"); } $n=0; } } #Now, all regions without Ns are in @regions my $cont=1; my $laststart=1; if ($#regions>=0) { for (my $i=0;$i<=$#regions;$i++) { my ($ini,$end)=split /\s+/,$regions[$i]; my $cini=$laststart; my $cend=$ini-1; my $pseqobj=$seqobj->trunc($cini,$cend); my $new_id=$contig . "_p$cont"; $cont++; $pseqobj->display_id("$new_id"); $out->write_seq($pseqobj); print SCAFF "$new_id $cini $cend\n"; my $linksize=$end-$ini+1; print SCAFF "LINK $ini $end $linksize\n"; $laststart=$end+1; } my $lastregion=$regions[$#regions]; # print "$lastregion $#regions\n"; die; my ($ini,$end)= split /\s+/,$lastregion; if (($end+1)<$lenseq) { my $cini=$end+1; my $cend=$lenseq; my $pseqobj=$seqobj->trunc($end+1,$lenseq); my $new_id=$contig . "_p$cont"; $pseqobj->display_id("$new_id"); $out->write_seq($pseqobj); print SCAFF "$new_id $cini $cend\n"; } } else { $seqobj->display_id("$contig.1.1"); $out->write_seq($seqobj); print SCAFF "$contig.1.1 1 $lenseq\n"; } } close(SCAFF);]]> Rahul Nayak https://bioinformaticsonline.com/snippets/view/37656/perl-script-to-extract-a-sequence-from-multifasta-with-range Sat, 08 Sep 2018 09:55:49 -0500 https://bioinformaticsonline.com/snippets/view/37656/perl-script-to-extract-a-sequence-from-multifasta-with-range # filterfastarange.pl #!/usr/bin/perl use strict; use warnings; #perl filterfastarange.pl 301 600 contigs.fasta > contigs-gt300-lte600.fasta my $minlen = shift or die "Error: `minlen` parameter not provided\n"; my $maxlen = shift or die "Error: `maxlen` parameter not provided\n"; { local $/=">"; while(<>) { chomp; next unless /\w/; s/>$//gs; my @chunk = split /\n/; my $header = shift @chunk; my $seqlen = length join "", @chunk; print ">$_" if($seqlen >= $minlen and $seqlen <= maxlen); } local $/="\n"; }]]> BioStar https://bioinformaticsonline.com/snippets/view/37615/update-zsh-on-ubuntu Thu, 30 Aug 2018 18:50:37 -0500 https://bioinformaticsonline.com/snippets/view/37615/update-zsh-on-ubuntu ➜ upgrade_oh_my_zsh Updating Oh My Zsh remote: Counting objects: 484, done. remote: Compressing objects: 100% (243/243), done. remote: Total 484 (delta 290), reused 392 (delta 214), pack-reused 0 Receiving objects: 100% (484/484), 87.73 KiB | 10.97 MiB/s, done. Resolving deltas: 100% (290/290), completed with 127 local objects. From https://github.com/robbyrussell/oh-my-zsh * branch master -> FETCH_HEAD 9544316e..dc8811f8 master -> origin/master Updating 9544316e..dc8811f8 Fast-forward lib/functions.zsh | 3 +- lib/misc.zsh | 2 +- lib/prompt_info_functions.zsh | 2 +- lib/spectrum.zsh | 2 +- lib/termsupport.zsh | 2 +- plugins/asdf/asdf.plugin.zsh | 19 ++++-- plugins/bbedit/README.md | 6 +- plugins/bgnotify/README.md | 2 +- plugins/brew/brew.plugin.zsh | 2 + plugins/bundler/README.md | 6 +- plugins/bwana/bwana.plugin.zsh | 4 +- plugins/catimg/catimg.plugin.zsh | 2 +- plugins/catimg/catimg.sh | 2 +- plugins/coffee/_coffee | 4 +- plugins/command-not-found/command-not-found.plugin.zsh | 2 +- plugins/composer/composer.plugin.zsh | 9 ++- plugins/dash/dash.plugin.zsh | 86 ++++++++++++++++++++++++ plugins/debian/debian.plugin.zsh | 2 +- plugins/docker-machine/_docker-machine | 359 +++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ plugins/docker/_docker | 11 ++- plugins/doctl/doctl.plugin.zsh | 9 +++ plugins/dotenv/README.md | 2 +- plugins/dotenv/dotenv.plugin.zsh | 7 +- plugins/droplr/README.md | 2 +- plugins/ember-cli/README.md | 5 +- plugins/ember-cli/ember-cli.plugin.zsh | 3 +- plugins/emoji/README.md | 6 +- plugins/emoji/emoji-data.txt | 4 +- plugins/emoji/update_emoji.pl | 12 ++-- plugins/extract/_extract | 2 +- plugins/extract/extract.plugin.zsh | 6 +- plugins/firewalld/firewalld.plugin.zsh | 2 +- plugins/forklift/README.md | 2 +- plugins/forklift/forklift.plugin.zsh | 100 ++++++++++++++++++--------- plugins/frontend-search/README.md | 12 ++-- plugins/frontend-search/frontend-search.plugin.zsh | 10 +-- plugins/geeknote/README.md | 2 +- plugins/git-extras/README.md | 2 +- plugins/git-extras/git-extras.plugin.zsh | 231 ++++++++++++++++++++++++++++++++++++++++++++++++++++---------- plugins/git-flow-avh/git-flow-avh.plugin.zsh | 4 +- plugins/git-hubflow/git-hubflow.plugin.zsh | 2 +- plugins/git-prompt/git-prompt.plugin.zsh | 2 +- plugins/git-prompt/gitstatus.py | 2 +- plugins/git/git.plugin.zsh | 5 +- plugins/github/README.md | 6 +- plugins/github/github.plugin.zsh | 6 +- plugins/globalias/README.md | 2 +- plugins/golang/golang.plugin.zsh | 5 +- plugins/gradle/gradle.plugin.zsh | 12 ++++ plugins/hanami/README.md | 4 +- plugins/heroku/_heroku | 199 ------------------------------------------------------ plugins/heroku/heroku.plugin.zsh | 9 +++ plugins/history-substring-search/README.md | 6 +- plugins/httpie/README.md | 4 +- plugins/jake-node/jake-node.plugin.zsh | 4 +- plugins/jenv/README.md | 13 ++++ plugins/jenv/jenv.plugin.zsh | 30 +++++++++ plugins/kitchen/_kitchen | 4 +- plugins/kube-ps1/kube-ps1.plugin.zsh | 2 +- plugins/kubectl/kubectl.plugin.zsh | 79 +++++++++++++--------- plugins/lighthouse/lighthouse.plugin.zsh | 2 +- plugins/lol/lol.plugin.zsh | 4 +- plugins/mix-fast/README.md | 4 +- plugins/mvn/mvn.plugin.zsh | 14 ++++ plugins/nmap/nmap.plugin.zsh | 4 +- plugins/nyan/nyan.plugin.zsh | 15 +++-- plugins/osx/osx.plugin.zsh | 2 +- plugins/osx/spotify | 2 +- plugins/pass/_pass | 17 +++-- plugins/per-directory-history/README.md | 24 +++---- plugins/per-directory-history/per-directory-history.zsh | 2 +- plugins/percol/README.md | 3 - plugins/perl/perl.plugin.zsh | 2 +- plugins/pod/_pod | 2 +- plugins/pow/pow.plugin.zsh | 2 +- plugins/rake-fast/README.md | 2 +- plugins/repo/README.md | 2 +- plugins/safe-paste/safe-paste.plugin.zsh | 4 +- plugins/sbt/sbt.plugin.zsh | 2 +- plugins/scala/_scala | 4 +- plugins/scd/README.md | 4 +- plugins/scw/_scw | 2 +- plugins/shrink-path/README.md | 6 +- plugins/shrink-path/shrink-path.plugin.zsh | 6 +- plugins/spring/README.md | 10 +-- plugins/sprunge/sprunge.plugin.zsh | 22 +++--- plugins/ssh-agent/README.md | 2 +- plugins/sublime/README.md | 2 +- plugins/svn/README.md | 2 +- plugins/swiftpm/_swift | 362 ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ plugins/systemadmin/systemadmin.plugin.zsh | 1 - plugins/systemd/systemd.plugin.zsh | 6 ++ plugins/taskwarrior/README.md | 2 +- plugins/taskwarrior/_task | 2 +- plugins/textastic/README.md | 4 +- plugins/tmux/tmux.plugin.zsh | 153 ++++++++++++++++++++--------------------- plugins/ubuntu/ubuntu.plugin.zsh | 2 +- plugins/urltools/urltools.plugin.zsh | 2 +- plugins/vault/README.md | 8 +-- plugins/vi-mode/vi-mode.plugin.zsh | 6 ++ plugins/wp-cli/README.md | 6 +- plugins/wp-cli/wp-cli.plugin.zsh | 2 +- plugins/xcode/xcode.plugin.zsh | 2 +- plugins/z/z.1 | 6 +- plugins/z/z.sh | 75 ++++++++++++--------- plugins/zsh-navigation-tools/LICENSE | 8 +-- templates/zshrc.zsh-template | 21 +++--- themes/adben.zsh-theme | 6 +- themes/agnoster.zsh-theme | 19 ++++-- themes/arrow.zsh-theme | 2 +- themes/avit.zsh-theme | 2 +- themes/bira.zsh-theme | 2 +- themes/clean.zsh-theme | 2 +- themes/duellj.zsh-theme | 2 +- themes/fino-time.zsh-theme | 8 ++- themes/fino.zsh-theme | 6 +- themes/funky.zsh-theme | 4 +- themes/gnzh.zsh-theme | 1 - themes/half-life.zsh-theme | 4 +- themes/itchy.zsh-theme | 2 - themes/jreese.zsh-theme | 2 - themes/lambda.zsh-theme | 2 - themes/lukerandall.zsh-theme | 2 +- themes/macovsky-ruby.zsh-theme | 2 +- themes/macovsky.zsh-theme | 2 +- themes/mh.zsh-theme | 4 +- themes/michelebologna.zsh-theme | 10 +-- themes/mikeh.zsh-theme | 4 +- themes/philips.zsh-theme | 2 +- themes/pmcgee.zsh-theme | 2 +- themes/rkj.zsh-theme | 2 +- themes/sorin.zsh-theme | 8 +-- themes/sporty_256.zsh-theme | 2 +- themes/steeef.zsh-theme | 4 +- themes/sunaku.zsh-theme | 1 - themes/tonotdo.zsh-theme | 4 +- themes/trapd00r.zsh-theme | 111 ++++++++++++++++++++---------- themes/xiong-chiamiov-plus.zsh-theme | 2 +- themes/xiong-chiamiov.zsh-theme | 2 +- tools/theme_chooser.sh | 2 +- 140 files changed, 1710 insertions(+), 703 deletions(-) create mode 100644 plugins/dash/dash.plugin.zsh create mode 100644 plugins/docker-machine/_docker-machine create mode 100644 plugins/doctl/doctl.plugin.zsh delete mode 100644 plugins/heroku/_heroku create mode 100644 plugins/heroku/heroku.plugin.zsh create mode 100644 plugins/jenv/README.md create mode 100644 plugins/jenv/jenv.plugin.zsh create mode 100644 plugins/swiftpm/_swift mode change 100644 => 100755 themes/trapd00r.zsh-theme Current branch master is up to date. __ __ ____ / /_ ____ ___ __ __ ____ _____/ /_ / __ \/ __ \ / __ `__ \/ / / / /_ / / ___/ __ \ / /_/ / / / / / / / / / / /_/ / / /_(__ ) / / / \____/_/ /_/ /_/ /_/ /_/\__, / /___/____/_/ /_/ /____/ Hooray! Oh My Zsh has been updated and/or is at the current version. To keep up on the latest news and updates, follow us on twitter: https://twitter.com/ohmyzsh Get your Oh My Zsh swag at: https://shop.planetargon.com/ ➜]]> Jit https://bioinformaticsonline.com/snippets/view/37613/downloading-gatk Thu, 30 Aug 2018 04:54:01 -0500 https://bioinformaticsonline.com/snippets/view/37613/downloading-gatk jitendra@jitendra-UNLOCK-INSTALL[SNP] wget https://github.com/broadinstitute/gatk/releases/download/4.0.2.1/gatk-4.0.2.1.zip --2018-08-30 11:47:20-- https://github.com/broadinstitute/gatk/releases/download/4.0.2.1/gatk-4.0.2.1.zip Resolving github.com (github.com)... 192.30.253.113, 192.30.253.112 Connecting to github.com (github.com)|192.30.253.113|:443... connected. HTTP request sent, awaiting response... 302 Found Location: https://github-production-release-asset-2e65be.s3.amazonaws.com/27452807/b52ea0c4-1e27-11e8-8de3-124a69f123c8?X-Amz-Algorithm=AWS4-HMAC-SHA256&X-Amz-Credential=AKIAIWNJYAX4CSVEH53A%2F20180830%2Fus-east-1%2Fs3%2Faws4_request&X-Amz-Date=20180830T094721Z&X-Amz-Expires=300&X-Amz-Signature=891dad1fa9f625f83ccfdc7a1fcbf39d4ceecb227a6da4ac5ee61d2945414d7e&X-Amz-SignedHeaders=host&actor_id=0&response-content-disposition=attachment%3B%20filename%3Dgatk-4.0.2.1.zip&response-content-type=application%2Foctet-stream [following] --2018-08-30 11:47:21-- https://github-production-release-asset-2e65be.s3.amazonaws.com/27452807/b52ea0c4-1e27-11e8-8de3-124a69f123c8?X-Amz-Algorithm=AWS4-HMAC-SHA256&X-Amz-Credential=AKIAIWNJYAX4CSVEH53A%2F20180830%2Fus-east-1%2Fs3%2Faws4_request&X-Amz-Date=20180830T094721Z&X-Amz-Expires=300&X-Amz-Signature=891dad1fa9f625f83ccfdc7a1fcbf39d4ceecb227a6da4ac5ee61d2945414d7e&X-Amz-SignedHeaders=host&actor_id=0&response-content-disposition=attachment%3B%20filename%3Dgatk-4.0.2.1.zip&response-content-type=application%2Foctet-stream Resolving github-production-release-asset-2e65be.s3.amazonaws.com (github-production-release-asset-2e65be.s3.amazonaws.com)... 52.216.227.56 Connecting to github-production-release-asset-2e65be.s3.amazonaws.com (github-production-release-asset-2e65be.s3.amazonaws.com)|52.216.227.56|:443... connected. HTTP request sent, awaiting response... 200 OK Length: 346889796 (331M) [application/octet-stream] Saving to: ‘gatk-4.0.2.1.zip’ gatk-4.0.2.1.zip 100%[===================>] 330,82M 8,66MB/s in 1m 41s 2018-08-30 11:49:03 (3,27 MB/s) - ‘gatk-4.0.2.1.zip’ saved [346889796/346889796] jitendra@jitendra-UNLOCK-INSTALL[gatk-4.0.2.1] ./gatk [] Usage template for all tools (uses --spark-runner LOCAL when used with a Spark tool) gatk AnyTool toolArgs Usage template for Spark tools (will NOT work on non-Spark tools) gatk SparkTool toolArgs [ -- --spark-runner <LOCAL | SPARK | GCS> sparkArgs ] Getting help gatk --list Print the list of available tools gatk Tool --help Print help on a particular tool Configuration File Specification --gatk-config-file PATH/TO/GATK/PROPERTIES/FILE gatk forwards commands to GATK and adds some sugar for submitting spark jobs --spark-runner <target> controls how spark tools are run valid targets are: LOCAL: run using the in-memory spark runner SPARK: run using spark-submit on an existing cluster --spark-master must be specified --spark-submit-command may be specified to control the Spark submit command arguments to spark-submit may optionally be specified after -- GCS: run using Google cloud dataproc commands after the -- will be passed to dataproc --cluster <your-cluster> must be specified after the -- spark properties and some common spark-submit parameters will be translated to dataproc equivalents --dry-run may be specified to output the generated command line without running it --java-options 'OPTION1[ OPTION2=Y ... ]' optional - pass the given string of options to the java JVM at runtime. Java options MUST be passed inside a single string with space-separated values. jitendra@jitendra-UNLOCK-INSTALL[gatk-4.0.2.1] ./gatk --list [] Using GATK jar /media/jitendra/OSDisk/SNP/gatk-4.0.2.1/gatk-package-4.0.2.1-local.jar Running: java -Dsamjdk.use_async_io_read_samtools=false -Dsamjdk.use_async_io_write_samtools=true -Dsamjdk.use_async_io_write_tribble=false -Dsamjdk.compression_level=1 -jar /media/jitendra/OSDisk/SNP/gatk-4.0.2.1/gatk-package-4.0.2.1-local.jar --help OpenJDK 64-Bit Server VM warning: Insufficient space for shared memory file: 13132 Try using the -Djava.io.tmpdir= option to select an alternate temp location. USAGE: <program name> [-h] Available Programs: -------------------------------------------------------------------------------------- Base Calling: Tools that process sequencing machine data, e.g. Illumina base calls, and detect sequencing level attributes, e.g. adapters CheckIlluminaDirectory (Picard) Asserts the validity for specified Illumina basecalling data. CollectIlluminaBasecallingMetrics (Picard) Collects Illumina Basecalling metrics for a sequencing run. CollectIlluminaLaneMetrics (Picard) Collects Illumina lane metrics for the given BaseCalling analysis directory. ExtractIlluminaBarcodes (Picard) Tool determines the barcode for each read in an Illumina lane. IlluminaBasecallsToFastq (Picard) Generate FASTQ file(s) from Illumina basecall read data. IlluminaBasecallsToSam (Picard) Transforms raw Illumina sequencing data into an unmapped SAM or BAM file. MarkIlluminaAdapters (Picard) Reads a SAM or BAM file and rewrites it with new adapter-trimming tags. -------------------------------------------------------------------------------------- Copy Number Variant Discovery: Tools that analyze read coverage to detect copy number variants. AnnotateIntervals (BETA Tool) Annotates intervals with GC content CallCopyRatioSegments (BETA Tool) Calls copy-ratio segments as amplified, deleted, or copy-number neutral CombineSegmentBreakpoints (EXPERIMENTAL Tool) Combine the breakpoints of two segment files and annotate the resulting intervals with chosen columns from each file. CreateReadCountPanelOfNormals (BETA Tool) Creates a panel of normals for read-count denoising DenoiseReadCounts (BETA Tool) Denoises read counts to produce denoised copy ratios DetermineGermlineContigPloidy (BETA Tool) Determines the baseline contig ploidy for germline samples given counts data GermlineCNVCaller (BETA Tool) Calls copy-number variants in germline samples given their counts and the output of DetermineGermlineContigPloidy ModelSegments (BETA Tool) Models segmented copy ratios from denoised read counts and segmented minor-allele fractions from allelic counts PlotDenoisedCopyRatios (BETA Tool) Creates plots of denoised copy ratios PlotModeledSegments (BETA Tool) Creates plots of denoised and segmented copy-ratio and minor-allele-fraction estimates PostprocessGermlineCNVCalls Create a VCF given the output of GermlineCNVCaller. -------------------------------------------------------------------------------------- Coverage Analysis: Tools that count coverage, e.g. depth per allele ASEReadCounter Generates table of filtered base counts at het sites for allele specific expression CollectAllelicCounts (BETA Tool) Collects reference and alternate allele counts at specified sites CollectFragmentCounts (BETA Tool) Collects fragment counts at specified intervals CountBases Count bases in a SAM/BAM/CRAM file CountBasesSpark (BETA Tool) Counts bases in the input SAM/BAM CountReads Count reads in a SAM/BAM/CRAM file CountReadsSpark (BETA Tool) Counts reads in the input SAM/BAM GetPileupSummaries (BETA Tool) Tabulates pileup metrics for inferring contamination Pileup Prints read alignments in samtools pileup format PileupSpark (BETA Tool) Prints read alignments in samtools pileup format -------------------------------------------------------------------------------------- Diagnostics and Quality Control: Tools that collect sequencing quality related and comparative metrics AccumulateVariantCallingMetrics (Picard) Combines multiple Variant Calling Metrics files into a single file AnalyzeCovariates Evaluate and compare base quality score recalibration (BQSR) tables BamIndexStats (Picard) Generate index statistics from a BAM file CalcMetadataSpark (BETA Tool) (Internal) Collects read metrics relevant to structural variant discovery CalculateContamination Calculate the fraction of reads coming from cross-sample contamination CalculateReadGroupChecksum (Picard) Creates a hash code based on the read groups (RG). CheckFingerprint (Picard) Computes a fingerprint from the supplied input (SAM/BAM or VCF) file and compares it to the provided genotypes CheckPileup Compare GATK's internal pileup to a reference Samtools mpileup CheckTerminatorBlock (Picard) Asserts the provided gzip file's (e.g., BAM) last block is well-formed; RC 100 otherwise ClusterCrosscheckMetrics (Picard) Clusters the results of a CrosscheckFingerprints run by LOD score CollectAlignmentSummaryMetrics (Picard) <b>Produces a summary of alignment metrics from a SAM or BAM file.</b> CollectBaseDistributionByCycle (Picard) Chart the nucleotide distribution per cycle in a SAM or BAM file CollectBaseDistributionByCycleSpark (BETA Tool) Collects base distribution per cycle in SAM/BAM/CRAM file(s). CollectGcBiasMetrics (Picard) Collect metrics regarding GC bias. CollectHiSeqXPfFailMetrics (Picard) Classify PF-Failing reads in a HiSeqX Illumina Basecalling directory into various categories. CollectHsMetrics (Picard) Collects hybrid-selection (HS) metrics for a SAM or BAM file. CollectIndependentReplicateMetrics (Picard) (BETA Tool) (Experimental) Estimates the rate of independent replication of reads within a bam. CollectInsertSizeMetrics (Picard) Collect metrics about the insert size distribution of a paired-end library. CollectInsertSizeMetricsSpark (BETA Tool) Collects insert size distribution information on alignment data CollectJumpingLibraryMetrics (Picard) Collect jumping library metrics. CollectMultipleMetrics (Picard) Collect multiple classes of metrics. CollectMultipleMetricsSpark (BETA Tool) Runs multiple metrics collection modules for a given alignment file CollectOxoGMetrics (Picard) Collect metrics to assess oxidative artifacts. CollectQualityYieldMetrics (Picard) Collect metrics about reads that pass quality thresholds and Illumina-specific filters. CollectQualityYieldMetricsSpark (BETA Tool) Collects quality yield metrics from SAM/BAM/CRAM file(s). CollectRawWgsMetrics (Picard) Collect whole genome sequencing-related metrics. CollectRnaSeqMetrics (Picard) Produces RNA alignment metrics for a SAM or BAM file. CollectRrbsMetrics (Picard) <b>Collects metrics from reduced representation bisulfite sequencing (Rrbs) data.</b> CollectSequencingArtifactMetrics (Picard) Collect metrics to quantify single-base sequencing artifacts. CollectTargetedPcrMetrics (Picard) Calculate PCR-related metrics from targeted sequencing data. CollectVariantCallingMetrics (Picard) Collects per-sample and aggregate (spanning all samples) metrics from the provided VCF file CollectWgsMetrics (Picard) Collect metrics about coverage and performance of whole genome sequencing (WGS) experiments. CollectWgsMetricsWithNonZeroCoverage (Picard)(BETA Tool) (Experimental) Collect metrics about coverage and performance of whole genome sequencing (WGS) experiments. CompareBaseQualities Compares the base qualities of two SAM/BAM/CRAM files CompareDuplicatesSpark (BETA Tool) Determine if two potentially identical BAMs have the same duplicate reads CompareMetrics (Picard) Compare two metrics files. CompareSAMs (Picard) Compare two input ".sam" or ".bam" files. ConvertSequencingArtifactToOxoG (Picard) Extract OxoG metrics from generalized artifacts metrics. CrosscheckFingerprints (Picard) Checks that all data in the input files appear to have come from the same individual CrosscheckReadGroupFingerprints (Picard) DEPRECATED: USE CrosscheckFingerprints. Checks if all read groups appear to come from the same individual. EstimateLibraryComplexity (Picard) Estimates the numbers of unique molecules in a sequencing library. EstimateLibraryComplexityGATK (BETA Tool) Estimate library complexity from the sequence of read pairs FilterLongReadAlignmentsSAMSpark (EXPERIMENTAL Tool) Examines alignments of chimeric contigs, attempting to produce an optimal tiling FlagStat Accumulate flag statistics given a BAM file FlagStatSpark (BETA Tool) Spark tool to accumulate flag statistics GetSampleName (BETA Tool) Emit a single sample name MeanQualityByCycle (Picard) Collect mean quality by cycle. MeanQualityByCycleSpark (BETA Tool) MeanQualityByCycle on Spark QualityScoreDistribution (Picard) Chart the distribution of quality scores. QualityScoreDistributionSpark (BETA Tool) QualityScoreDistribution on Spark ValidateSamFile (Picard) Validates a SAM or BAM file. ViewSam (Picard) Prints a SAM or BAM file to the screen -------------------------------------------------------------------------------------- Intervals Manipulation: Tools that process genomic intervals in various formats BedToIntervalList (Picard) Converts a BED file to a Picard Interval List. IntervalListToBed (Picard) Converts an Picard IntervalList file to a BED file. IntervalListTools (Picard) A tool for performing various IntervalList manipulations LiftOverIntervalList (Picard) Lifts over an interval list from one reference build to another. PreprocessIntervals (BETA Tool) Prepares bins for coverage collection SplitIntervals Split intervals into sub-interval files. -------------------------------------------------------------------------------------- Metagenomics: Tools that perform metagenomic analysis, e.g. microbial community composition and pathogen detection PathSeqBuildKmers Builds set of host reference k-mers PathSeqBuildReferenceTaxonomy Builds a taxonomy datafile of the microbe reference PathSeqBwaSpark Step 2: Aligns reads to the microbe reference PathSeqFilterSpark Step 1: Filters low quality, low complexity, duplicate, and host reads PathSeqPipelineSpark Combined tool that performs all steps: read filtering, microbe reference alignment, and abundance scoring PathSeqScoreSpark Step 3: Classifies pathogen-aligned reads and generates abundance scores -------------------------------------------------------------------------------------- Other: Miscellaneous tools, e.g. those that aid in data streaming CreateHadoopBamSplittingIndex (BETA Tool) Create a Hadoop BAM splitting index FifoBuffer (Picard) Provides a large, FIFO buffer that can be used to buffer input and output streams between programs. GatherBQSRReports Gathers scattered BQSR recalibration reports into a single file GatherTranches (BETA Tool) Gathers scattered VQSLOD tranches into a single file IndexFeatureFile Creates an index for a feature file, e.g. VCF or BED file. ParallelCopyGCSDirectoryIntoHDFSSpark (BETA Tool) Parallel copy a file or directory from Google Cloud Storage into the HDFS file system used by Spark -------------------------------------------------------------------------------------- Read Data Manipulation: Tools that manipulate read data in SAM, BAM or CRAM format AddCommentsToBam (Picard) Adds comments to the header of a BAM file. AddOrReplaceReadGroups (Picard) Assigns all the reads in a file to a single new read-group. ApplyBQSR Apply base quality score recalibration ApplyBQSRSpark (BETA Tool) Apply base quality score recalibration on Spark BQSRPipelineSpark (BETA Tool) Both steps of BQSR (BaseRecalibrator and ApplyBQSR) on Spark BamToBfq (Picard) Converts a BAM file into a BFQ (binary fastq formatted) file BaseRecalibrator Generates recalibration table for Base Quality Score Recalibration (BQSR) BaseRecalibratorSpark (BETA Tool) Generate recalibration table for Base Quality Score Recalibration (BQSR) on Spark BaseRecalibratorSparkSharded (EXPERIMENTAL Tool) BaseRecalibrator on Spark (experimental sharded implementation) BuildBamIndex (Picard) Generates a BAM index ".bai" file. BwaAndMarkDuplicatesPipelineSpark (BETA Tool) Takes name-sorted file and runs BWA and MarkDuplicates. BwaSpark (BETA Tool) BWA on Spark CleanSam (Picard) Cleans the provided SAM/BAM, soft-clipping beyond-end-of-reference alignments and setting MAPQ to 0 for unmapped reads ClipReads Clip reads in a SAM/BAM/CRAM file ConvertHeaderlessHadoopBamShardToBam (BETA Tool) Convert a headerless BAM shard into a readable BAM DownsampleSam (Picard) Downsample a SAM or BAM file. ExtractOriginalAlignmentRecordsByNameSpark (BETA Tool) Subsets reads by name FastqToSam (Picard) Converts a FASTQ file to an unaligned BAM or SAM file FilterSamReads (Picard) Subsets reads from a SAM or BAM file by applying one of several filters. FixMateInformation (Picard) Verify mate-pair information between mates and fix if needed. FixMisencodedBaseQualityReads Fix Illumina base quality scores in a SAM/BAM/CRAM file GatherBamFiles (Picard) Concatenate efficiently BAM files that resulted from a scattered parallel analysis LeftAlignIndels Left-aligns indels from reads in a SAM/BAM/CRAM file MarkDuplicates (Picard) Identifies duplicate reads. MarkDuplicatesGATK (EXPERIMENTAL Tool) Examines aligned records in the supplied SAM/BAM/CRAM file to locate duplicate molecules. MarkDuplicatesSpark (BETA Tool) MarkDuplicates on Spark MarkDuplicatesWithMateCigar (Picard) Identifies duplicate reads, accounting for mate CIGAR. MergeBamAlignment (Picard) Merge alignment data from a SAM or BAM with data in an unmapped BAM file. MergeSamFiles (Picard) Merges multiple SAM and/or BAM files into a single file. PositionBasedDownsampleSam (Picard) Downsample a SAM or BAM file to retain a subset of the reads based on the reads location in each tile in the flowcell. PrintReads Print reads in the SAM/BAM/CRAM file PrintReadsSpark (BETA Tool) PrintReads on Spark ReorderSam (Picard) Reorders reads in a SAM or BAM file to match ordering in a second reference file. ReplaceSamHeader (Picard) Replaces the SAMFileHeader in a SAM or BAM file. RevertBaseQualityScores Revert Quality Scores in a SAM/BAM/CRAM file RevertOriginalBaseQualitiesAndAddMateCigar (Picard)Reverts the original base qualities and adds the mate cigar tag to read-group BAMs RevertSam (Picard) Reverts SAM or BAM files to a previous state. SamFormatConverter (Picard) Convert a BAM file to a SAM file, or a SAM to a BAM SamToFastq (Picard) Converts a SAM or BAM file to FASTQ. SetNmAndUqTags (Picard) DEPRECATED: Use SetNmMdAndUqTags instead. SetNmMdAndUqTags (Picard) Fixes the NM, MD, and UQ tags in a SAM file SimpleMarkDuplicatesWithMateCigar (Picard) (BETA Tool) (Experimental) Examines aligned records in the supplied SAM or BAM file to locate duplicate molecules. SortSam (Picard) Sorts a SAM or BAM file SortSamSpark (BETA Tool) SortSam on Spark (works on SAM/BAM/CRAM) SplitNCigarReads Split Reads with N in Cigar SplitReads Outputs reads from a SAM/BAM/CRAM by read group, sample and library name SplitSamByLibrary (Picard) Splits a SAM or BAM file into individual files by library SplitSamByNumberOfReads (Picard) Splits a SAM or BAM file to multiple BAMs. UmiAwareMarkDuplicatesWithMateCigar (Picard) (BETA Tool) Identifies duplicate reads using information from read positions and UMIs. UnmarkDuplicates Clears the 0x400 duplicate SAM flag -------------------------------------------------------------------------------------- Reference: Tools that analyze and manipulate FASTA format references BaitDesigner (Picard) Designs oligonucleotide baits for hybrid selection reactions. BwaMemIndexImageCreator Create a BWA-MEM index image file for use with GATK BWA tools CreateSequenceDictionary (Picard) Creates a sequence dictionary for a reference sequence. ExtractSequences (Picard) Subsets intervals from a reference sequence to a new FASTA file. FindBadGenomicKmersSpark (BETA Tool) Identifies sequences that occur at high frequency in a reference NonNFastaSize (Picard) Counts the number of non-N bases in a fasta file. NormalizeFasta (Picard) Normalizes lines of sequence in a FASTA file to be of the same length. ScatterIntervalsByNs (Picard) Writes an interval list created by splitting a reference at Ns. -------------------------------------------------------------------------------------- Short Variant Discovery: Tools that perform variant calling and genotyping for short variants (SNPs, SNVs and Indels) CombineGVCFs Merges one or more HaplotypeCaller GVCF files into a single GVCF with appropriate annotations GenomicsDBImport Import VCFs to GenomicsDB GenotypeGVCFs Perform joint genotyping on one or more samples pre-called with HaplotypeCaller HaplotypeCaller Call germline SNPs and indels via local re-assembly of haplotypes HaplotypeCallerSpark (BETA Tool) HaplotypeCaller on Spark Mutect2 Call somatic SNVs and indels via local assembly of haplotypes ReadsPipelineSpark (BETA Tool) Takes unaligned or aligned reads and runs BWA (if specified), MarkDuplicates, BQSR, and HaplotypeCaller to generate a VCF file of variants -------------------------------------------------------------------------------------- Structural Variant Discovery: Tools that detect structural variants DiscoverVariantsFromContigAlignmentsSAMSpark (BETA Tool) (Internal) Examines aligned contigs from local assemblies and calls structural variants ExtractSVEvidenceSpark (BETA Tool) (Internal) Extracts evidence of structural variations from reads FindBreakpointEvidenceSpark (BETA Tool) (Internal) Produces local assemblies of genomic regions that may harbor structural variants StructuralVariationDiscoveryPipelineSpark (BETA Tool) Runs the structural variation discovery workflow on a single sample SvDiscoverFromLocalAssemblyContigAlignmentsSpark (BETA Tool) (Internal) Examines aligned contigs from local assemblies and calls complex structural variants -------------------------------------------------------------------------------------- Variant Evaluation and Refinement: Tools that evaluate and refine variant calls, e.g. with annotations not offered by the engine AnnotatePairOrientation (BETA Tool) (EXPERIMENTAL) Annotate a non-M2 VCF (using the associated tumor bam) with pair orientation fields (e.g. F1R2 ). AnnotateVcfWithBamDepth (Internal) Annotate a vcf with a bams read depth at each variant locus AnnotateVcfWithExpectedAlleleFraction (Internal) Annotate a vcf with expected allele fractions in pooled sequencing CalculateGenotypePosteriors Calculate genotype posterior probabilities given family and/or known population genotypes CalculateMixingFractions (Internal) Calculate proportions of different samples in a pooled bam Concordance (BETA Tool) Evaluate concordance of an input VCF against a validated truth VCF CountFalsePositives (BETA Tool) Count PASS variants CountVariants Counts variant records in a VCF file, regardless of filter status. CountVariantsSpark (BETA Tool) CountVariants on Spark FindMendelianViolations (Picard) Finds mendelian violations of all types within a VCF Funcotator (BETA Tool) Functional Annotator GenotypeConcordance (Picard) Calculates the concordance between genotype data of one samples in each of two VCFs - one being considered the truth (or reference) the other being the call. The concordance is broken into separate results sections for SNPs and indels. Statistics are reported in three different files. NeuralNetInference (EXPERIMENTAL Tool) Apply 1d Convolutional Neural Net to filter annotated variants ValidateBasicSomaticShortMutations (EXPERIMENTAL Tool) Check the variants in a VCF against a tumor-normal pair of bams representing the same samples, though not the ones from the actual calls. ValidateVariants Validate VCF VariantsToTable Extract fields from a VCF file to a tab-delimited table -------------------------------------------------------------------------------------- Variant Filtering: Tools that filter variants by annotating the FILTER column ApplyVQSR Apply a score cutoff to filter variants based on a recalibration table CreateSomaticPanelOfNormals (BETA Tool) Make a panel of normals for use with Mutect2 FilterByOrientationBias (EXPERIMENTAL Tool) Filter Mutect2 somatic variant calls using orientation bias FilterMutectCalls Filter somatic SNVs and indels called by Mutect2 FilterVcf (Picard) Hard filters a VCF. VariantFiltration Filter variant calls based on INFO and/or FORMAT annotations VariantRecalibrator Build a recalibration model to score variant quality for filtering purposes -------------------------------------------------------------------------------------- Variant Manipulation: Tools that manipulate variant call format (VCF) data FixVcfHeader (Picard) Replaces or fixes a VCF header. GatherVcfs (Picard) Gathers multiple VCF files from a scatter operation into a single VCF file GatherVcfsCloud (BETA Tool) Gathers multiple VCF files from a scatter operation into a single VCF file LiftoverVcf (Picard) Lifts over a VCF file from one reference build to another. MakeSitesOnlyVcf (Picard) Creates a VCF that contains all the site-level information for all records in the input VCF but no genotype information. MergeVcfs (Picard) Combines multiple variant files into a single variant file PrintVariantsSpark (BETA Tool) Prints out variants from the input VCF. RemoveNearbyIndels (Internal) Remove indels from the VCF file that are close to each other. RenameSampleInVcf (Picard) Renames a sample within a VCF or BCF. SelectVariants Select a subset of variants from a VCF file SortVcf (Picard) Sorts one or more VCF files. SplitVcfs (Picard) Splits SNPs and INDELs into separate files. UpdateVCFSequenceDictionary Updates the sequence dictionary in a variant file. UpdateVcfSequenceDictionary (Picard) Takes a VCF and a second file that contains a sequence dictionary and updates the VCF with the new sequence dictionary. VariantAnnotator (BETA Tool) Tool for adding annotations to VCF files VcfFormatConverter (Picard) Converts VCF to BCF or BCF to VCF. VcfToIntervalList (Picard) Converts a VCF or BCF file to a Picard Interval List --------------------------------------------------------------------------------------]]> Jit