Our Sponsors



Download BioinformaticsOnline(BOL) Apps in your chrome browser.

Freelancer

AdvertiseWithUs

Clump Finding Problem Solved with Perl

  • Public
By Jit 40 days ago
#Find patterns forming clumps in a string. #Given: A string Genome, and integers k, L, and t. #Return: All distinct k-mers forming (L, t)-clumps in Genome. use strict; use warnings; my %myHash; my $string="CGGACTCGACAGATGTGAAGAAATGTGAAGACTGAGTGAAGAGAAGAGGAAACACGACACGACATTGCGACATAATGTACGAATGTAATGTGCCTATGGC"; my $subStr="?"; my $clump=4; my $kmer=5; for (my $aa=0; $aa<=(length($string)-$kmer); $aa++) { my $myStr=substr $string, $aa,$kmer; #print "$myStr\n"; my $km=kmerMatch ($string, $myStr, $kmer); #if ($km > $max) { $max = $km;} #print "$km\t$myStr\n"; $myHash{$myStr}=$km; } #Print all key which have matching values foreach my $name (keys %myHash){ print "$name " if $myHash{$name} == $clump; } kmerMatch ($string, $subStr, $kmer); sub kmerMatch { #Check the exact matching kmers with sliding window my ($string, $myStr, $kmer)=@_; my $count=0; for (my $aa=0; $aa<=(length($string)-4); $aa++) { my $myWin=substr $string, $aa,$kmer; if ($myWin eq $myStr) { #print "$myWin eq $myStr\n"; $count++; } } return $count; }