Frequent words problem solution by Perl
...my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";my $kmer=4; my %myHash;my $max=0;for (...bsp; my $myStr=substr $string, $aa,$kmer; #print "$m...; print "$name " if $myHash{$name} == $max;}sub kmerMatch { #Check the exact match...3280 days ago
Pattern Matching Problem Solution with Perl
...where Pattern appears as a substring. Use 0-based indexing.use strict;use warnings;my $string="GATATATGCATATACTT";my $subStr="ATAT";my $kmer=length($subStr);kmerMatch ($string, $subStr, $kmer...3280 days ago
Genome Assembly Tools and Software - PART2 !!
...RePS 2.0 – WGS Sequence AssemblerRePS (Repeat-masked Phrap with scaffolding), a WGS sequence assembler, that explicitly identifies exact kmer repeats from the shotgun data...2713 days ago