BBTools for bioinformatician !
...------Reformat.sh Count k-mers/find unknown primers Code: $ reform...100 AAATTTTTTTCCCCCCCCCC 85 ...etc. If the primers are 20bp long, they should b...ge is similar to bbmap.sh or mapPacBio.sh. For primers, which I assume will be shor...2268 days ago
Illumina based assembly pipeline steps !
...lling Read alignment (Bowtie 2) Sort and index alignments (SAMtools) Primer sequence removal (iVar; ampli...Intersect variants across callers (BCFTools) De novo assembly Primer trimming (Cutadapt; amplicon...874 days ago