Results for "Script"

Tags

  • Bioinformatics Scripts

    Some of the useful bioinformatics scripts. For example ... contig-stats.pl is a Perl script that will automatically describe features of a sequence assembly. http://milkweedgenome.org/?q=scripts

    Tags: Bioinformatics, Computational Biology, Education, Study, Script, Perl, Python

    911 days ago

  • Creates 100 random DNA sequences with 20 residues. sapply(1:100, function(x) paste(sample(c("A","T","G","C"), 20, replace=T), collapse="")) #R #Random #Sequence #DNA #Script

    Tags: R, Random, Sequence, DNA, Script

    1176 days ago

  • Introduction to programming. Write short programs that generate graphics and animation.

    Introduction to programming. Write short programs that generate graphics and animation. http://funprogramming.org/

    Tags: Fun, Program, Animation, Script

    1102 days ago

  • Making Your Code Citable http://computationalproteomic.blogspot.in/2014/08/making-your-code-citable.html #Code #Repository #Citable #Script

    Tags: Code, Repository, Citable, Script

    1016 days ago

  • Coding Ground

    Online coding group for most of the programming languages. Code in almost all popular languages using Coding Ground. Edit, compile, execute and share your projects, 100% cloud. http://www.tutorialspoint.com/codingground.htm

    Tags: Bioinformatics, Languages, Coding, Programming, Learn, Code, Script

    888 days ago

  • Perl One liner basics !!

    Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:$ perl -e 'pr...

    Tags: Bioinformatics, Computational Biology, Education, Study, Script, Perl, Oneliner, Basic

    820 days ago

  • Reverse Complement Problem Solved with Perl

    Question at http://rosalind.info/problems/1b/ #Find the reverse complement of a DNA string.#Given: A DNA string Pattern.#Return: Pattern, the reverse complement of Pattern.use strict;use warnings;my $string="AAAACCCGGT";my $finalString="";my %hash = (    "C" => "G",   ...

    Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Reserve, Complementary

    803 days ago

  • Pattern Matching Problem Solution with Perl

    Problem at http://rosalind.info/problems/1c/ #Find all occurrences of a pattern in a string.#Given: Strings Pattern and Genome.#Return: All starting positions in Genome where Pattern appears as a substring. Use 0-based indexing.use strict;use warnings;my $string="GATATATGCATATACTT";my $subStr="A...

    Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Rosalind

    803 days ago

  • Rosalind Problem Solution with Perl

    Rosalind is a platform for learning bioinformatics and programming through problem solving. Take a tour to get the hang of how Rosalind works. Bioinformatics Textbook Track Find more about Rosalind puzzle at http://rosalind.info/problems/list-view/?location=bioinformatics-textbook-track I will...

    Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Rosalind

    803 days ago

  • Frequent words problem solution by Perl

    Solved with perl http://rosalind.info/problems/1a/ #Find the most frequent k-mers in a string.#Given: A DNA string Text and an integer k.#Return: All most frequent k-mers in Text (in any order).use strict;use warnings;my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";my $kmer=4; my %myHash;my $max=0...

    Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Rosalind

    803 days ago