Results for "convert"

Blogs

  • BBTools for bioinformatician !

    ...Code: ACCGTTACCGTTACCGTTAC 100 AAATTTTTTTCCCCCCCCCC 85 ...etc. If the primers are 20bp long, they should be pretty obvious.   Convert SAM format from 1.4 to 1.3 (r...

    2261 days ago

  • Understanding liftOver !

    ...s to the same reference build. LiftOver can have three use cases: (1) Convert genome position from one geno...C hg 18) and hope to lift them over to NCBI build 37 (UCSC hg19). (2) Convert dbSNP rs number from one buil...

    2151 days ago

  • Install ImageMagick from Unix Source

    ...dy to use ImageMagick to convert, compose, or edit your i...nts... 1572864checking how to convert x86_64-pc-linux-gnu file name...m... /bin/rmchecking for rsvg-convert... rsvg-convertchecking for i...c -m 644 ./www/api/MagickWand/convert_8c.html /usr/local/share/doc/...

    2137 days ago

  • Converting a VCF into a FASTA given some reference !

    ...es a Perl script vcfutils.pl which does this, the function vcf2fq (lines 469-528) This script has been modified by others to convert InDels as well, e.g. thi...

    2107 days ago