Our Sponsors



Download BioinformaticsOnline(BOL) Apps in your chrome browser.

Freelancer

AdvertiseWithUs

Fill up the form and blast with perl

  • Public
By BioStar 32 days ago
use WWW::Mechanize; use strict; use warnings; my $mech = WWW::Mechanize->new; my $sequence = 'GCCCGCGGTCTCAGAGATCTCGATATATTATA'; $mech->get('http://www.arabidopsis.org/Blast/'); $mech->submit_form( form_name => 'myForm', fields => { 'Algorithm' => 'blastx', 'BlastTargetSet' => 'ATH1_pep', 'QueryText' => $sequence, }, ); print $mech->content;