Our Sponsors



Download BioinformaticsOnline(BOL) Apps in your chrome browser.






Question: Question: Annotating a sequence not yet published

ruchira
4492 days ago

Question: Annotating a sequence not yet published

I have 198,991 bp long sequence. I ran it through Maker, Glimmer and GeneMarkS. All three gave me different number of predicted genes.Here I am talking about genes that I got through GeneMarkS.

Now when I am using BlastX to find the similar genes, I sometimes get highly dissimilar results. What does that indicate?

For eg:- for the given gene

>gene_id_13
ATGTTCGCGGGCGTAGTGCGCAGTTTCGTGCAGTGGAGACGAGTCGATGACACCGCCGTC
AGAGACGGTGAATGGCAAGACGAACGCGGCCGGATTGACTGGTTCGAATGA

After running blastX for gene 13, I get results with evalue 4.3 and above and sequences that are only 43% similar.

  33.1 33.1 81% 4.3 43% WP_017418739.1

>gene_id_14
ATGCTCGGACTGATGAAGGCCTGCAAAAAGCTCGGCCTGTCGTTCTGGCAGTATCTCTGT
GATCGCATCGGTGTCGATGGCCAGGCCATTCCGCCGCTGGCCGCCCTTGTCGGGGCAAAA
GCCTAA

with this gene, i got the following result

  76.6 76.6 97% 5e-16 80% CDM61676.1

Now if I combine genes 13 and 14. I got

  78.2 78.2 92% 4e-16 57% CDM61676.1

what does that suggest? 

Also, how to find the correct number of predicted genes when all three tools give different results?

Thanks

Answers
0

Hi Ruchira,

It looks confusing to me as well, and question remain WHY? I guess it might be due to parameter differences. I will suggest you to please read this manuscript entitled "A beginner’s guide to eukaryotic genome annotation" http://fasta.bioch.virginia.edu/cshl/pdf/12/ajm12/euk_genome_annotation_review.pdf . I hope it will be helpful for your research point of view.

Exercise at http://bix.ucsd.edu/bioalgorithms/problems/03_asmt.htm

Thanks

0

Hi Ruchira,

          I Think There is Different software using Different Algorithm that's why something result look like different.But u can use GENESCAN. GENESCAN gives accurate result and also used world wide gene prediction tool.

GENESCAN : http://genes.mit.edu/GENSCAN.html

Thank you.