BBTools for bioinformatician !
...-----Reformat.sh Count k-mers/find unknown primers Code: $ reforma...00 AAATTTTTTTCCCCCCCCCC 85 ...etc. If the primers are 20bp long, they should be...e is similar to bbmap.sh or mapPacBio.sh. For primers, which I assume will be short...2294 days ago
Bioinformatics tools to explore SSRs in genomes !
...ious organisms and can identify perfect, compound, and imperfect SSRs. Primer3: Primer3 is a web-based tool that designs PCR primers for SSRs. It can design primers for perfect and imperfect SSR...449 days ago
Common methods to discover tandem repeats
...ose in the database. PCR-based methods: Polymerase chain reaction (PCR) can be used to amplify and detect tandem repeats in genomic DNA. PCR primers are designed to flank the tan...447 days ago