Results for "6"
Bio-Scripts
Bash script to simulate a genome !
...s/bbmap/ /genetics/elbers/bbmap-38.86/mutate.sh \ in=GCA_003401745...a_upper.diploid.fasta.gz \ ziplevel=6 \ ploidy=2 \ subrate=0.0192...s/bbmap/ /genetics/elbers/bbmap-38.86/randomreads.sh build=1 \ see...12000bp /genetics/elbers/bbmap-38.86/randomreads.sh build=1 \ ow=...976 days ago
Extract the values using ids !
...file1 file2 Look: $ cat file1 11002 10995 48981 79600 $ cat file2 10993 item 0 11002 item 6 10995 item 7 79600 i...72557 item 7 224325 item 7 84156 item 6 572546 item 7 693661 item 7...953 days ago
Run Pango on your multifasta file !
...Input_for_Cova_all_samples_combined.fa (pangolin) [jnarayan@hn1 FASTA]$ pangolin --update pangolin already latest release (v3.1.16) pangolearn updated to 2021-...946 days ago
Omicron Sequences accession number !
EPI_ISL_6647956 EPI_ISL_6647957 EPI_ISL_6647958 EPI_ISL_6647959 EPI_ISL_6647960 EPI_ISL_6647962 EPI_ISL_6647961 Search the IDs in https://www.epicov.org/epi3/frontend944 days ago
Extract fasta header with ids !
.../../../../DATABASE/minikraken_20171019_8GB.tgz out.fa more out.fa_class.txt | grep "227859" | awk '{print $2}' > all_real_ids.txt minimap2 -t 36 -k19 -w5 -A1 -B2 -O3,13 -E2,1...935 days ago
- ...----------- backports.functools_lru_cache-1.6.4| pyhd3eb1b0_0 9 KB conda-4.11.0 | py38h06a4308_0 14.4 MB co...3-py38h578d9b~ --> pkgs/main::conda-4.11.0-py38h06a4308_0 conda-package-han~...
921 days ago
Installing SEVA environment in Conda !
...100% libdeflate-1.8 | 67 KB | ###################...00% r-jsonlite-1.7.2 | 462 KB | ####################...0% r-testthat-3.0.2 | 1.6 MB | #####################...##### | 100% gfortran_linux-64-9. | 24 KB | ###########...896 days ago
- ...| h0a1914f_2 190 KB conda-forge ruby-2.6.6 | he592...rity channel: ca-certificates pkgs/main::ca-certificates-2021.10.26~ --> conda-forge::ca-certific...
884 days ago
- ....14.12 | h7636065_2 905 KB fo...Total: 16.8 MB The following NEW pac...i pkgs/main/linux-64::libffi-3.3-he6710b0_2 li...100% graphviz-2.40.1 | 6.5 MB | ###################...
883 days ago
bash script to extract sequence by ids !
...reate test input: cat > in.fasta BGI_novel_T016313 Solyc03g025570.2.1 TTCAAG...0075.1.1 GCAAGGGAAAGAAGTATTACTAG >BGI_novel_T016817 BGI_novel_G001220 GCCCAAG...cat out.fasta Output: >BGI_novel_T016697 Solyc03g033550.3.1 CTGACG...882 days ago
