Results for "Computational Biology"
Tags
Affy has acquired Eureka Genomics for 15M $
Affymetrix Acquires Assets Of Eureka Genomics Corporation To Provide High Throughput And Economical Crop And Animal Genotyping http://www.thestreet.com/story/13151062/1/affymetrix-acquires-assets-of-eureka-genomics-corporation-to-provide-high-throughput-and-economical-crop-and-animal-genotyping....Tags: Bioinformatics, Computational Biology, Education, Affymetrix, Acquires, Eureka, Genomics, Corporation
3287 days ago
- Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:$ perl -e 'pr...
Tags: Bioinformatics, Computational Biology, Education, Study, Script, Perl, Oneliner, Basic
3284 days ago
- Our research group is primarily focused on the analysis of whole genome sequence data to identify genetic variation (primarily structural variation) and examine their potential functional impact in disease phenotypes. We are particularly interested in analyzing complex regions of the genome that ...
Tags: Bioinformatics, Computational Biology, Genomics, RNAseq, NGS, Chromosome, Ryan E. Mills
3282 days ago
- The goal of our research is to better understand the biology of microbial organisms of significant ecological, veterinary and medical importance. To achieve this goal, our team combines the power of next generation DNA sequencing and bioinformatics with molecular biology and experimental proced...
Tags: Bioinformatics, Computational Biology, Genomics, RNAseq, NGS, omics, Comparative Genomics, Parasite, Evolution, Nicolas Corradi
3281 days ago
Reverse Complement Problem Solved with Perl
Question at http://rosalind.info/problems/1b/ #Find the reverse complement of a DNA string.#Given: A DNA string Pattern.#Return: Pattern, the reverse complement of Pattern.use strict;use warnings;my $string="AAAACCCGGT";my $finalString="";my %hash = ( "C" => "G", ...Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Reserve, Complementary
3267 days ago
Frequent words problem solution by Perl
Solved with perl http://rosalind.info/problems/1a/ #Find the most frequent k-mers in a string.#Given: A DNA string Text and an integer k.#Return: All most frequent k-mers in Text (in any order).use strict;use warnings;my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";my $kmer=4; my %myHash;my $max=0...Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Rosalind
3267 days ago
Pattern Matching Problem Solution with Perl
Problem at http://rosalind.info/problems/1c/ #Find all occurrences of a pattern in a string.#Given: Strings Pattern and Genome.#Return: All starting positions in Genome where Pattern appears as a substring. Use 0-based indexing.use strict;use warnings;my $string="GATATATGCATATACTT";my $subStr="A...Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Rosalind
3267 days ago
Rosalind Problem Solution with Perl
Rosalind is a platform for learning bioinformatics and programming through problem solving. Take a tour to get the hang of how Rosalind works. Bioinformatics Textbook Track Find more about Rosalind puzzle at http://rosalind.info/problems/list-view/?location=bioinformatics-textbook-track I will...Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Rosalind
3267 days ago
Clump Finding Problem Solved with Perl
The question at http://rosalind.info/problems/1d/ Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perlTags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Clump, Rosalind
2349 days ago
- What is new? Expansion of Protists and Fungi with hundreds of annotated genomes Variation data for bread wheat, rice, Aedes aegypti, and Ixodes scapularis Whole genome alignments for O. longistaminata and T. cacao Non-coding RNA gene models in Bacteria New assembly of tomato (version 2.50)...
Tags: Bioinformatics, Computational Biology, Genomics, Comparative Genomics, Ensembl
3260 days ago
