Tags: Fasta, Clean, Perl, NNN charaters
3859 days ago
Extract the numeric values from the multiple FASTA sequence file.
I have a multiple fasta sequence file (~12GB size) with certain coordinate information:> chr13-/454-4567654 (2347645)AGTGACTGACTGAAGTGACTGA > chr14-/524-8367954 (6535786)AGTGACTGAAGTGACTGAThe fasta sequence string would always have only one or more continuous stretch of numbers, like ...Tags: Extract, Number, Fasta, Coordinates
3640 days ago