Results for "Study"
Tags
Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:$ perl -e 'pr...Tags: Bioinformatics, Computational Biology, Education, Study, Script, Perl, Oneliner, Basic
3277 days ago
Frequent words problem solution by Perl
Solved with perl http://rosalind.info/problems/1a/ #Find the most frequent k-mers in a string.#Given: A DNA string Text and an integer k.#Return: All most frequent k-mers in Text (in any order).use strict;use warnings;my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";my $kmer=4; my %myHash;my $max=0...Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Rosalind
3260 days ago
Reverse Complement Problem Solved with Perl
Question at http://rosalind.info/problems/1b/ #Find the reverse complement of a DNA string.#Given: A DNA string Pattern.#Return: Pattern, the reverse complement of Pattern.use strict;use warnings;my $string="AAAACCCGGT";my $finalString="";my %hash = ( "C" => "G", ...Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Reserve, Complementary
3260 days ago
Pattern Matching Problem Solution with Perl
Problem at http://rosalind.info/problems/1c/ #Find all occurrences of a pattern in a string.#Given: Strings Pattern and Genome.#Return: All starting positions in Genome where Pattern appears as a substring. Use 0-based indexing.use strict;use warnings;my $string="GATATATGCATATACTT";my $subStr="A...Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Rosalind
3260 days ago
Clump Finding Problem Solved with Perl
The question at http://rosalind.info/problems/1d/ Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perlTags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Clump, Rosalind
2342 days ago
Bioinformatics in Africa: Part2 - Kenya
International Livestock Research Institute (ILRI): Under a NEPAD initiative, the Biosciences Eastern and Central Africa (BECA) (www.biosciencesafrica.org) was established...Tags: Kenya, Africa, Bioinformatics, Training, Study
1192 days ago
Bioinformatics in Africa: Part3 - Mali
International Center for Excellence in Research (ICER): The ICER is a research center composed of the following three programs: 1. The Malaria Research and Training Center &nbs...Tags: Bioinformatics, Africa, Mali, Study, Learn
1192 days ago
Bioinformatics in Africa: Part 4 - Morocco
Bioinformatics, in the UFR in Artificial Intelligence and Bioinformatics, deals with the management, the analysis, the modelling and the visualization of biological databases. Since the size of the databases is often exponential, the traditional algorithms are not very effective when seeking for ...Tags: Bioinformatics. Africa, Morocco, Study, Training, Learn
1192 days ago
