Results for "bioinformatics"
Tags
We use couple of hundreads of command in daily basis. Most of them are actually repeated several time. The question remain open how do I search old command history under bash shell and modify or reuse it? Now a days almost all modern shell allows you to search command history if enabled by user. ...Tags: Bioinformatics, Computational Biology, Linux, History, Search, Find, Delete, Shell, Command
3620 days ago
A guide for complete R beginners :- R Syntax
R is a functional based language, the inputs to a function, including options, are in brackets. Note that all dat and options are separated by a comma Function(data, options) Even quit is a function q() So is help help(read.table) Provides the help page for the FUNCTION ‘r...Tags: Bioinformatics, Computational Biology, Education, Tutorial, R, Basics, Syntax
3363 days ago
A guide for complete R beginners :- Getting data into R
For a beginner this can be is the hardest part, it is also the most important to get right. It is possible to create a vector by typing data directly into R using the combine function ‘c’ x same as x creates the vector x with the numbers between 1 and 5. You can see wh...Tags: Bioinformatics, Computational Biology, Education, Tutorial, R, Basics, Syntax, Data
3363 days ago
A guide for complete R beginners :- Installing R packages
Part of the reason R has become so popular is the vast array of packages available at the cran and bioconductor repositories. In the last few years, the number of packages has grown exponentially! This is a short post giving steps on how to actually install R packages. Let’s suppose you wa...Tags: Bioinformatics, Computational Biology, Education, Tutorial, R, Basics, Syntax, Install, Packages
3363 days ago
- Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:$ perl -e 'pr...
Tags: Bioinformatics, Computational Biology, Education, Study, Script, Perl, Oneliner, Basic
3274 days ago
Frequent words problem solution by Perl
Solved with perl http://rosalind.info/problems/1a/ #Find the most frequent k-mers in a string.#Given: A DNA string Text and an integer k.#Return: All most frequent k-mers in Text (in any order).use strict;use warnings;my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";my $kmer=4; my %myHash;my $max=0...Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Rosalind
3257 days ago
Reverse Complement Problem Solved with Perl
Question at http://rosalind.info/problems/1b/ #Find the reverse complement of a DNA string.#Given: A DNA string Pattern.#Return: Pattern, the reverse complement of Pattern.use strict;use warnings;my $string="AAAACCCGGT";my $finalString="";my %hash = ( "C" => "G", ...Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Reserve, Complementary
3257 days ago
Pattern Matching Problem Solution with Perl
Problem at http://rosalind.info/problems/1c/ #Find all occurrences of a pattern in a string.#Given: Strings Pattern and Genome.#Return: All starting positions in Genome where Pattern appears as a substring. Use 0-based indexing.use strict;use warnings;my $string="GATATATGCATATACTT";my $subStr="A...Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Rosalind
3257 days ago
Clump Finding Problem Solved with Perl
The question at http://rosalind.info/problems/1d/ Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perlTags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Clump, Rosalind
2339 days ago
Genome Assembly Tools and Software - PART2 !!
The genome assemblers generally take a file of short sequence reads and a file of quality-value as the input. Since the quality-value file for the high throughput short reads is usually highly memory-intensive, only a few assemblers, best suited for your assembly. For the sake of computational me...Tags: Bioinformatics, Genome, Assembly, RNA, DNA, Sequence, NGS
2691 days ago
