BOL: Results for "characters"

Results for "characters"

- Radha Agarkar@radhaagarkar
Find and replace ambiguous characters in fasta file with Perl and Bioperl
...-m: missing character\n". "Print out the name of sequences with characters other than ATGC-.\n". "If -m is specified, the ambiguous characters are repleced with the\n"....
2923 days ago
- Jit@jit.aber
Find the number of each 2 consecutive characters AA, AC,AG,AT,CC,CA... with Perl
#!/usr/bin/perl -w use strict; my $subject = "AACGTACTGACGTACTGGTTGGTACGA"; my %results = (); while ($subject =~ m/[ACTG][ATGC]/g) { # matched text = $&...
2918 days ago
- Jit@jit.aber
Fastq-dump for SRA download
...ation for sequence. --defline-qual Defline format specification for quality. is string of characters and/or...
2135 days ago
- Surabhi Chaudhary@surabhi
Awk build in commands !
...and contains the field separator character which is used to divide fields on the input line. The default is “white space”, meaning space and tab characters. FS can be reassigned to anot...
904 days ago