Find and replace ambiguous characters in fasta file with Perl and Bioperl
...-m: missing character\n". "Print out the name of sequences with characters other than ATGC-.\n". "If -m is specified, the ambiguous characters are repleced with the\n"....2923 days ago
Find the number of each 2 consecutive characters AA, AC,AG,AT,CC,CA... with Perl
#!/usr/bin/perl -w use strict; my $subject = "AACGTACTGACGTACTGGTTGGTACGA"; my %results = (); while ($subject =~ m/[ACTG][ATGC]/g) { # matched text = $&...2918 days ago
2135 days ago
904 days ago