Results for "education"
Tags
A guide for complete R beginners :- R Syntax
R is a functional based language, the inputs to a function, including options, are in brackets. Note that all dat and options are separated by a comma Function(data, options) Even quit is a function q() So is help help(read.table) Provides the help page for the FUNCTION ‘r...Tags: Bioinformatics, Computational Biology, Education, Tutorial, R, Basics, Syntax
3371 days ago
A guide for complete R beginners :- Getting data into R
For a beginner this can be is the hardest part, it is also the most important to get right. It is possible to create a vector by typing data directly into R using the combine function ‘c’ x same as x creates the vector x with the numbers between 1 and 5. You can see wh...Tags: Bioinformatics, Computational Biology, Education, Tutorial, R, Basics, Syntax, Data
3371 days ago
A guide for complete R beginners :- Installing R packages
Part of the reason R has become so popular is the vast array of packages available at the cran and bioconductor repositories. In the last few years, the number of packages has grown exponentially! This is a short post giving steps on how to actually install R packages. Let’s suppose you wa...Tags: Bioinformatics, Computational Biology, Education, Tutorial, R, Basics, Syntax, Install, Packages
3371 days ago
- Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:$ perl -e 'pr...
Tags: Bioinformatics, Computational Biology, Education, Study, Script, Perl, Oneliner, Basic
3282 days ago
Frequent words problem solution by Perl
Solved with perl http://rosalind.info/problems/1a/ #Find the most frequent k-mers in a string.#Given: A DNA string Text and an integer k.#Return: All most frequent k-mers in Text (in any order).use strict;use warnings;my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";my $kmer=4; my %myHash;my $max=0...Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Rosalind
3266 days ago
Reverse Complement Problem Solved with Perl
Question at http://rosalind.info/problems/1b/ #Find the reverse complement of a DNA string.#Given: A DNA string Pattern.#Return: Pattern, the reverse complement of Pattern.use strict;use warnings;my $string="AAAACCCGGT";my $finalString="";my %hash = ( "C" => "G", ...Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Reserve, Complementary
3266 days ago
Pattern Matching Problem Solution with Perl
Problem at http://rosalind.info/problems/1c/ #Find all occurrences of a pattern in a string.#Given: Strings Pattern and Genome.#Return: All starting positions in Genome where Pattern appears as a substring. Use 0-based indexing.use strict;use warnings;my $string="GATATATGCATATACTT";my $subStr="A...Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Rosalind
3266 days ago
Clump Finding Problem Solved with Perl
The question at http://rosalind.info/problems/1d/ Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perlTags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Clump, Rosalind
2347 days ago
Bioinformatics in Africa: Part5 - Nigeria
Covenant University (CU)Ota:Covenant University (with her enriching and growing stateoftheart laboratories in the area of science and technology, arts, business and social sciences) is presently the Best University in Nigeria (Private University category), based on...Tags: Bioinformatics, Nigeria, Learn, Training, Education
1197 days ago
Bioinformatics in Africa: Part6 - Sudan
Commission for Biotechnology & Genetic Engineering Khartoum: The Commission for Biotechnology and Genetic Engineering was established in 9/2/1993 as research unit. In addition&...Tags: Bioinformatics, Sudan, Learn, Training, Education
1197 days ago
