Our Sponsors



Download BioinformaticsOnline(BOL) Apps in your chrome browser.






Perl script to find coding regions in DNA sequences

  • Public
By Shruti Paniwala 2917 days ago
#!/usr/bin/perl -w use strict; # if the number of input arguments is lower than 2 # return a message showing the error if (scalar(@ARGV) < 2) { print "dnaloglkh.pl codontable DNAsequence\n"; exit(1); } # create two vars contaning the filenames my $filecodontable = $ARGV[0]; my $filesequence = $ARGV[1]; # open the first file: table of codon usage frequencies if (!open(PROPCODONS,"< $filecodontable")) { print "dnaloglkh.pl: the file $filecodontable can not be opened\n"; exit(1); } # load the frequencies of codon usage into the hash table %pcodons # this hash is indexed by a triplet of nucleotides or codon my %pcodons; my ($codon,$freq); my $line; # for each line in the file (tableofcodons) do while ($line = ) { # extract the two values or columns with a regular expression # A group of letters and a decimal number ($codon,$freq) = ($line =~ m/(\w+) (\d+\.\d+)/); # load the hash table $pcodons{$codon}=$freq; } close(PROPCODONS); ########################################################## # open the DNA sequence (second file) if (!open(SEQUENCE,"< $filesequence")) { print "dnaloglkh.pl: the file $filesequence can not be opened\n"; exit(1); } # FASTA format: # >header containing a description of the sequence # AGACTGACTTAC # AGACTGACTTAC # AGACTGAC my $iden = ; # reading the header of the sequence my @seql = ; # load the complete sequence into an array my $seq = ""; # use a var to save the whole sequence inside close(SEQUENCE); # concat every segment (line) in the array into the var $seq my $i=0; while ($i < scalar(@seql)) { chomp($seql[$i]); $seq = $seq . $seql[$i]; $i = $i + 1; } $seq = "\U$seq"; # we are going to use the array @codons to store all of the codons in # the input DNA sequence. To split the sequence in segments of length # three, a regular expression will be used searching for all of the # possible groups of three symbols (option g) my @codons = ($seq =~ m/.../g); # the likelihood ratio is for a current triplet, the ratio between # the probability computed from the table of codon frequencies divided # by the random probability (uniform), that is, 1/64. After this, # the log must be applied to obtain the log-likelihood ratio. # It is recommended the use of logs to manage calculations involving # small numbers between 0 and 1. Log of the product is equal to the # the sum of logs and the log of the division is the substraction of logs my $r = 0.0; $i=0; while ($i < scalar(@codons)) { $r = $r + log($pcodons{$codons[$i]}) - log(1/64); $i = $i + 1; } printf "%.2f\n",$r; __END__ To test the program, save this two files in your current working directory: exon.fa and intron.fa. Both files contain the sequence of a real exon and intron, respectively. Extremely different values of coding potential should be obtained with the two sequences: high values (positive) for coding protein sequences and low values (zero or even negative) for intronic regions. exon.fa >HUMHBB.2ex GCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACT CCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCT TTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCT GCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGG intron.fa. >HUMHBB.2pin ATAACAATTGTTTTCTTTTGTTTAATTCTTGCTTTCTTTTTTTTTCTTCTCCGCAATTTTT ACTATTATACTTAATGCCTTAACATTGTGTATAACAAAAGGAAATATCTCTGAGATACATT AAGTAACTTAAAAAAAAACTTTACACAGTCTGCCTAGTACATTACTATTTGGAATATATGT GTGCTTATTTGCATATTCATAATCTCCCTACTTTATTTTC