#!/usr/bin/perl -w $DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC'; print "Here is the starting DNA:\n\n"; print "$DNA\n\n"; $revcom = reverse $DNA; $revcom =~ s/A/T/g; $revcom =~ s/T/A/g; $revcom =~ s/G/C/g; $revcom =~ s/C/G/g; print "Here is the reverse complement DNA: WRONG:\n\n"; print "$revcom\n"; print "\nThat was a bad algorithm, and the reverse complement was wrong!\n"; print "Try again ... \n\n"; # Make a new copy of the DNA (see why we saved the original?) $revcom = reverse $DNA; # See the text for a discussion of tr/// $revcom =~ tr/ACGTacgt/TGCAtgca/; print "Here is the reverse complement DNA:\n\n"; print "$revcom\n"; print "\nThis time it worked!\n\n"; exit;