Results for "Study"
Tags
Which Bioinformatics Journals Do You Follow?
Which are your favorite bioinformatics journals? The ones that you check every month or so, or that you are subscribed to?Tags: Bioinformatics, Computational Biology, Education, Study, Journals, Publication
3304 days ago
- Pondicherry University,Puducherry,on behalf of Department of Biotechnology, Government of India, will conduct the BINC examination in2015. The objective of this examination is to certify bioinformatics professionals, trained formally as well as self-trained.Registration will open from March 9,201...
Tags: Bioinformatics, Computational Biology, Education, Study, Degree, BINC, Examination, 2015, India, Certificate
3303 days ago
BINC Sample Question Paper !!!
BINC sample question paper for round ONE.Tags: Bioinformatics, Computational Biology, Education, Study, Degree, BINC, Examination, 2015, India, Certificate
3298 days ago
BINC Sample Question Paper !!!
BINC sample question paper round TWO.Tags: Bioinformatics, Computational Biology, Education, Study, Degree, BINC, Examination, 2015, India, Certificate
3298 days ago
BINC Sample Question Paper !!!
BINC sample question paper round THREE ...Tags: Bioinformatics, Computational Biology, Education, Study, Degree, BINC, Examination, 2015, India, Certificate
3298 days ago
BINC Sample Question Paper !!!
BINC sample question paper. Wish you all the best for BINC examination.Tags: Bioinformatics, Computational Biology, Education, Study, Degree, BINC, Examination, 2015, India, Certificate
3298 days ago
- BioInformatics National Certification (BINC) Examination 2015 organized by Department of Biotechnology, Government of India, New Delhi Pondicherry University, Puducherry
Tags: Bioinformatics, Computational Biology, Education, Study, Degree, BINC, Examination, 2015, India, Certificate
3297 days ago
- Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:$ perl -e 'pr...
Tags: Bioinformatics, Computational Biology, Education, Study, Script, Perl, Oneliner, Basic
3260 days ago
Frequent words problem solution by Perl
Solved with perl http://rosalind.info/problems/1a/ #Find the most frequent k-mers in a string.#Given: A DNA string Text and an integer k.#Return: All most frequent k-mers in Text (in any order).use strict;use warnings;my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";my $kmer=4; my %myHash;my $max=0...Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Rosalind
3243 days ago
Reverse Complement Problem Solved with Perl
Question at http://rosalind.info/problems/1b/ #Find the reverse complement of a DNA string.#Given: A DNA string Pattern.#Return: Pattern, the reverse complement of Pattern.use strict;use warnings;my $string="AAAACCCGGT";my $finalString="";my %hash = ( "C" => "G", ...Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Reserve, Complementary
3243 days ago
