• Blogs
  • LEGE
  • A Step-by-Step Guide to Running BLAST Offline

A Step-by-Step Guide to Running BLAST Offline

  • Public
By LEGE 544 days ago

BLAST (Basic Local Alignment Search Tool) is a powerful algorithm used to compare nucleotide or protein sequences to sequence databases, identifying regions of similarity. Running BLAST offline provides more control, ensures data security, and allows customization for specific research needs. Here’s a detailed guide to set up and run BLAST locally on your system.


Step 1: Install BLAST

  1. Download BLAST:

    • Visit the NCBI BLAST+ download page to download the appropriate version for your operating system (Windows, macOS, or Linux).
  2. Install BLAST:

    • Extract the downloaded archive. For Linux/Mac, use:
      tar -xvzf ncbi-blast-*.tar.gz
      cd ncbi-blast-*
      
    • Add the BLAST binary folder to your system PATH for easier access:
      export PATH=$PATH:/path/to/ncbi-blast-*/bin
      
  3. Verify Installation:
    Run the following command to ensure BLAST is installed correctly:

    blastn -version
    

Step 2: Prepare a Local Database

To run BLAST offline, you’ll need a sequence database.

  1. Download a Pre-Built Database (Optional):

    • NCBI provides ready-to-use databases such as nt, nr, and Swiss-Prot. Use the update_blastdb.pl script (bundled with BLAST) to download these:
      update_blastdb.pl --decompress nt
      
  2. Create a Custom Database:
    If you have specific sequences to use as a database:

    • Prepare a FASTA file containing the sequences.
    • Use makeblastdb to create a database:
      makeblastdb -in your_sequences.fasta -dbtype [nucl|prot] -out custom_db
      
      Replace [nucl|prot] with nucl for nucleotide sequences or prot for protein sequences.

Step 3: Prepare the Query Sequence

  • Save your query sequence(s) in FASTA format.
  • Ensure the file is properly formatted, with a header line starting with > followed by the sequence name, and the sequence on subsequent lines.

Example:

>query_sequence
ATGCGTAGCTAGCGTAGCTAGCTAGCTA

Step 4: Run BLAST

  1. Choose the Appropriate BLAST Tool:
    Depending on your data type:

    • blastn: For nucleotide-nucleotide searches.
    • blastp: For protein-protein searches.
    • blastx: Translates nucleotide sequences into proteins and compares them to a protein database.
    • tblastn: Compares protein sequences to a nucleotide database.
    • tblastx: Translates both nucleotide query and database sequences.
  2. Run the Command:
    Example command for blastn:

    blastn -query query.fasta -db custom_db -out results.txt -outfmt 6 -evalue 1e-5
    

    Explanation of Parameters:

    • -query: Specifies the query file.
    • -db: Points to the local database.
    • -out: Output file name.
    • -outfmt: Output format (e.g., 6 for tabular format).
    • -evalue: E-value cutoff for significance.

Step 5: Interpret Results

  1. Output Formats:

    • Default (outfmt 0): Human-readable format.
    • Tabular (outfmt 6): Includes fields like query ID, subject ID, percent identity, alignment length, etc.
  2. Analyze Results:
    Use tools like grep, Python, or R to parse and filter results for downstream analysis.


Step 6: Optimize Performance

For large datasets, BLAST can be resource-intensive. To improve performance:

  1. Multithreading:
    Use the -num_threads option to leverage multiple CPU cores:

    blastn -query query.fasta -db custom_db -out results.txt -num_threads 4
    
  2. Database Subsetting:
    Split large databases into smaller chunks for faster searches.

  3. Adjust Parameters:

    • Lower the -evalue threshold for stricter matches.
    • Use -max_target_seqs to limit the number of results per query.

Step 7: Update Databases (Optional)

If using NCBI databases, regularly update them to ensure the inclusion of the latest sequences:

update_blastdb.pl --decompress nt

Conclusion

Running BLAST offline is a straightforward process that offers flexibility and security for bioinformaticians working with sensitive data. By following this guide, you can harness the power of BLAST to analyze sequences efficiently and gain valuable biological insights.

For advanced use cases, explore BLAST’s customization options, such as custom scoring matrices, filtering, and iterative searches with tools like PSI-BLAST. Happy BLASTing!