Our Sponsors



Download BioinformaticsOnline(BOL) Apps in your chrome browser.




  • Bookmarks
  • Jit
  • Glia: a Graph/Smith-Waterman (partial order) aligner/realigner

Glia: a Graph/Smith-Waterman (partial order) aligner/realigner

https://github.com/ekg/glia

glia's main use is as a local realigner. It will realign reads to a set of known (or putative) variants in a VCF, both consuming and producing an ordered stream of BAM alignments. 

More at https://github.com/ekg/glia

glia -f ~/human_g1k_v37.fasta -t 20:62900077-62902077 -v variants.vcf.gz \
     -s AAATGTAAACATTTTATAGGGGATTCCCCTAAAAACAAAAAAACTTTCTGGGAAAGATTTTTCAAAAAATAAAA