Bio++ : C Language libraries for your biological need
...lity to estimate equilibrium frequencies.Various codon models: Muse & Gaut 1994, Yang & Nielsen 19...tribution, allowing for invariant classes.Covarion models.Model including gaps.Global clock tree likelihoo...3994 days ago
Virtual Bioinformatics Online Tutorial
There are several vitual online bioinformatics training centres. Here I provide some of them: Virtual Institute of BioinformaticsNational University of Ireland , I...3967 days ago
3967 days ago
List of pharmacogenomics companies in India
...dia are making their good impacts. Here is the list of few pharmacogenomics companies. Please add more if not mentioned here. Genomics in India www.ganitlabs.in www.sandor.co.in ww...3968 days ago
Linux SSH Client Commands for Bioinformatics
...ack to the localhost to perform some activity and go back to remote host again. In this case, you don&rsqu...tv. You can go back to the remote host ssh without entering the password again by bringing the background...3752 days ago
Check the Size of a directory & Free disk space.
...se this time suffixed with a 'k' if its kilobytes and 'M' if its Megabytes and 'G' if its Gigabytes.$ du -ahIf you are inter...e instead of kilobytes as the unit the output would have 'M' for Megabytes and 'G' for Gigabytes.Ex...3748 days ago
Check Linux server configuration !!
...m showing some basic commands using them you can gather the system/server informa...ed Hat Enterprise Linux Server release 5.5 (Tikanga)Kernel \r on an \m2.cat /etc/...ed Hat Enterprise Linux Server release 5.5 (Tikanga)Release: &nb...3698 days ago
Monitor running jobs on Linux server
...; 836562k free, 29862014k cachedSwap is just on-disk memory that can be used to “swap” out programs from main memory. Again, we’ll talk about thi...3667 days ago
3315 days ago
Frequent words problem solution by Perl
...A DNA string Text and an integer k.#Return: All most frequent k-mers in Text (in any order).use strict;use warnings;my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";my $kmer=4; my %myHash;...3298 days ago