Results for "GA"
Top-level pages
Gap filling or Contigs extensions tools !
...here are many tools to perform gap filling using Illumina short reads, for example "GapFiller: a de novo assembly approach to fill the gap within paired reads" or "Tow...blies using 454 reads. We used GAPresolution but it is not a ve...y; then try steps (1) and (2) again, adding these new sequencin...2220 days ago
LINKS scaffolder bloomfilter setting !
...ORMAT UNDER -s ! Paired MPET reads in their original outward orientation <- -> must be separated by ":" >template_name ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCG...2206 days ago
Understanding BLASTn output format 6 !
...BLASTn maps DNA against DNA, for example gene sequences against a reference genomeblastn ...mber of mismatches 6. gapopen number of gap openings...d pident qlen length mismatch gapope evalue bitscore"supported...sseqid pident length mismatch gapopen qstart qend sstart send...2194 days ago
List of non-commercial NGS genotype-calling software
...genotype likelihoods (samtools) and SNP and genotype calling (bcftools) GATK http://www.broadinstitute.o...n (LDA). The ‘feasible’ genealogies can be generated using Margarita (http://www.sanger.ac.uk/...2152 days ago
Parallel Processing with Perl !
...ctive with its piece of data (split file) and thus you have created 8 processes at one time which run without interfering with the other process. I again will not suggest writing ou...2135 days ago
- ...compiling the software on.on most *nix machines, typing echo $MACHTYPE will return the machine architecture type.On my CentOS 6 based system this gave: x86_64-redhat-linux-gnu...
2118 days ago
World promising health companies !
...range of health care products and services, such as health maintenance organizations (HMOs), point of service plans (POS), preferred provider organizations (PPOs), and managed...1642 days ago
Frequent parameters for bioinformatics tools !
...--cov-cutoff auto --phred-offset 33 HGAP Pbalign.task_options.min_ac...ions.min_confidence: 40 falcon_ns.task_options.HGAP_GenomeLength_str: 6000000...options.algorithm: best falcon_ns.task_options.HGAP_SeedLengthCutoff_str: -1 Ge...1341 days ago
Bioinformatics in Africa:- Part 1
...p;training in bioinformatics and genome data analysis. Shortterm training activities: The IPCI will organize in the month of May 2007...1245 days ago
- ...database to store Elgg's tables. We'll call the database elggalpha.mysql> create database elggalpha; Grant access to a user...below to initialize the Elgg database. Database Username elggalphauser User that has full p...
948 days ago
