Install BLAST in Ubuntu/Linux and Window !
.../ftp.ncbi.nlm.nih.gov/blast/executables/blast+/2.7.1/ncbi-blast-2.7.1+-win64.exe with your web browser..../ftp.ncbi.nlm.nih.gov/blast/executables/blast+/2.7.1/ncbi-blast-2.7.1+-win64.exe #Run this installer...1194 days ago
2957 days ago
2919 days ago
Perl script to insert sequence in contig !!
...} $s = "ATATGATGATAGATGATAGTAGATAGATAGATAGATAGATAG"; print "s = $s \n"; print 'insert = '.($s = insertSEQintoCONTIGatLOC( "CCCC ", $s , 26 ))."\n"; print " (now, s...2756 days ago
2740 days ago
BASH script for SelfBLAST a genome
...echo "Doing alignments -- BLASting"; blastn -task megablast -query $SEQ -db $MYDB -evalue 1e-5 -num_threads $THREAD -max_target_seqs 1 -outfmt '6 qseqid staxid qstart qend sse...2699 days ago
picard tools command to get some insert statistics
#picard tools to get some insert statistics to see whether our reads seem to be in the correct place #module load picard/2.0.1 java -Xmx16g -XX:PermSize=8g -jar $PICARD_HOME/pi...1384 days ago
2541 days ago
2516 days ago
2513 days ago