Needleman-Wunsch Algorithm in Perl
#!/usr/bin/perl # USAGE: perl nw.pl HEAGAWGHEE PAWHEAE BLOSUM50.txt -8 # See: "Biological sequence anaysis" Durbin et al. ed. CUP 1998, Pg. 19 # Needleman-Wunsch global...2933 days ago
Count GC Content in nucleotide sequence with Perl
...----------------------------------------------------------- #Deal with passed parameters #-------------------...e") ) { print "Couldn't create $out_file\n"; exit; } print "Parameters:\nfasta file = $fasta...2933 days ago
Perl script to extract lines with matching ids !!
#!/usr/bin/perl use strict; use warnings; my %patterns; #USAGE: perl extactByIds.pl Idsfile1 file2 > Result # Open file and get patterns to search for open(my $fh2,"2903 days ago
Perl script to find the absolute "full" path of the file !
#!/usr/bin/perl use Cwd; my $this_file_full_path = Cwd::abs_path(__FILE__); print "$this_file_full_path\n"; use Cwd qw/ realpath /; ## $0; this script my $path = realpath($0); print $path;2907 days ago
2899 days ago
Blast script to index and extract sequence !!
...GG TCACTAAATACTTTAACCAATATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTAC # generate the blast database $ makeblastdb -dbtype nucl -out EC -in EC4115.fa -parse_seqids # retreive an en...2879 days ago
2732 days ago
2721 days ago
Calculate ATGC percentage in parallel with perl
#!/usr/bin/perl use strict; use Parallel::ForkManager; use Bio::SeqIO; #usage: perl testParallel.pl my %sequences; my...specific information my $pm = new Parallel::ForkManager($max_procs...[$child]); $pm->finish($child); # pass an exit code to finish }...2683 days ago
BASH script for SelfBLAST a genome
...enome exists" else echo "Thanks for testing this script $USER; Me creating creating blastDB named $MYDB for you"; makeblastdb -in $FASTAFILE -parse_seqids -dbtype nucl -out $...2679 days ago