Results for "B"
Bio-Scripts
Perl script to rename the fasta file !
#Script #1 #!/usr/bin/perl -w use strict; #USAGE #perl extractPattern.pl kmerfasta > uniref100_result_broad my %kHash; local $/ = '>'; my $infile2 = "$ARGV[0]"; # Kmer fasta open( FH2, '919 days ago
Extract the sequences with IDs !
#sed -i 's/\_/ /g' Delta_seqID_from_lineage_report.txt seqtk subseq genomic.fna Delta_seqID_from_lineage_report.txt > Delta.fasta #Split the fasta in 11 equal sequences subsets pyfasta split -n 11 Delta.fasta912 days ago
- # bash cat INFILE.fastq | paste - - - - |cut -f 1, 2| se...cat infile.fq | awk '{if(NR%4==1) {printf(">%s\n",substr($0,2));} else if(NR%4==2)...#seqtk seqtk seq -a input.fastq > output.fasta #Bioawk bioawk -c fastx '{print...
911 days ago
- ...ampleClass.php languages/ en.php vendors/ example_3rd_party_lib/ views/ default/.../ action.php other_action.php object/ example.php...
899 days ago
Installing SEVA environment in Conda !
...ng and Extracting Packages libtiff-4.3.0 | 614 KB | ########################...r-rmarkdown-2.8 | 3.1 MB | ########################...gcc_linux-64-9.4.0 | 24 KB | #######################...r-cli-2.5.0 | 533 KB | ########################...899 days ago
Extract all fasta sequences except ids !
awk 'BEGIN{while((getline0)l[">"$1]=1}/^>/{f...tered_without_omi.fasta #extract subseq seqtk subseq omi_ids.fa omi_single_id.t...# Extract the kmer of omi seqtk subseq kmercollection.fasta ../om..._formated.fa > omi_kmer19_formated_numbered.fa # cat all *.rd file...889 days ago
- [abhi@hn1 MetaCarvel]$ conda install -c conda-forge ruby Collecting package metadata...ded / updated specs: - ruby The following packages...| he592edb_2 5.5 MB conda-forge...ng and Extracting Packages gdbm-1.18 | 190 KB...
886 days ago
- (abhiENV) [abhi@hn1 output_OM824]$ conda cr...| h4ff587b_1 1.7 MB graphvi...4::_openmp_mutex-4.5-1_gnu blas pkgs/main/li....19.2-py36h54aff64_0 numpy-base pkgs/main/linux-64...mgsc -i [path to your assembly graph] -o [output directory...
886 days ago
bash script to extract sequence by ids !
...e a Perl one-liner, grep and seqtk subseq to extract the desired fas...Create test input: cat > in.fasta BGI_novel_T016313 Solyc03g025570.2.1 TTCAAGTGTTAGTTTCACATCAT >BGI_novel_T018109 Solyc03g08007...espond to desired gene ids: seqtk subseq in.fasta ids.selected.txt...884 days ago
Install Install Gffcompare on Ubuntu / Linux
...feature format (GFF) and general transfer format (GTF) files. It has a binary distribution compatible with the linu...symlink. # download and extract cd ~/workspace/bin wget http://ccb.jhu.edu/software/stringtie/dl...884 days ago
