Results for "C"
Bio-Scripts
# bash cat INFILE.fastq | paste - - - - |cut -f 1, 2| sed 's/@/>/'g | tr -s "/t" "/n" > OUTFILE.fasta #awk cat infile.fq | awk '{if(NR%4==...input.fastq > output.fasta #Bioawk bioawk -c fastx '{print ">"$name"\n"$se...910 days ago
- ...le would go in /mod/example/ actions/ example/ action.php other_action...Namespace/ PluginNamespace/ ExampleClass.p...component.js component.png forms/...example/ all.css all.js...
898 days ago
Installing SEVA environment in Conda !
(base) [jnarayan@hn1 SEVA_codes_and_files]$ conda env create -f SEVA.yaml Collecting package metadata (re...#################### | 100% r-clipr-0.7.1 | 65 KB...############## | 100% r-selectr-0.4_2 | 475 KB | ##...#### | 100% Preparing transaction: done Verifying transact...898 days ago
Extract all fasta sequences except ids !
...>"$1]=1}/^>/{f=!l[$1]}f' genomic.fna > filtered_without_omi.fasta #extract subseq seqtk subseq omi_ids..._id.txt > omi_single_id.fa #cat omi and all the rest cat o...id_plus_all.fa -k 19 # Extract the kmer of omi seqtk subse..._hits #count the lines in each file -- go in folder for FI...889 days ago
- [abhi@hn1 MetaCarvel]$ conda install -c conda-forge ruby Collecting package metadata (current_repodata.json): done S...1914f_2 ruby conda-forge/linux-64::ruby-2.6....action: done Verifying transaction: done Executing transact...
885 days ago
- ...ENV) [abhi@hn1 output_OM824]$ conda create -n mgsc python=3.6 graphviz numpy Collecting package metadata (cu...6.8 MB The following NEW packages will be INSTALLED:...ain/linux-64::libpng-1.6.37-hbc83047_0 libstdcxx-ng...#### | 100% Preparing transaction: done Verifying transact...
885 days ago
bash script to extract sequence by ids !
...r, grep and seqtk subseq to extract the desired fasta sequences: # Create test input:...> in.fasta BGI_novel_T016313 Solyc03g025570.2.1 TTCAAGTGTTAGTTT...ovel_T016817 BGI_novel_G001220 GCCCAAGTCATAGGTAGTGCCTG >BGI_no...# Extract fasta sequence that correspond to desired gene ids:...884 days ago
Install Install Gffcompare on Ubuntu / Linux
#Gffcompare is a program that is used to perf...TF) files. It has a binary distribution compatible with the linux we’re using so we will just download, extract, and make a symlink. # do...ar.gz # make symlink ln -s ~/workspace/bin/gffcompare-0.9.8.Linux_x...884 days ago
- #R is a feature rich interpretive programming lan...s R libraries available on bioconductor. It takes a several m...uld need to download and extract the source code. Next we’d c...all to build the software and copy the files to their proper...~/workspace/bin/R-3.5.1/bin/Rscript ~/workspace/bin/Rscript...
884 days ago
Install StringTie on ubuntu / Linux !
...software program to perform transcript assembly and quantification of RNAseq data. The bina...s are available so to install we can just download this distribu...to find. # download and extract cd ~/workspace/bin wget ht...# test installation ~/workspace/bin/stringtie -h...884 days ago
