122 days ago
Perl and BioPerl script to extract protein sequences using GFF file !
#!/usr/bin/perl use strict; use warnings; use Bio::DB::Fasta; use Bio::SeqIO; # Paths to your GFF file and genome FASTA file my $gff_file = 'path/to/your/file.gff'; my $genome_...122 days ago
Raku script to find repeats in sequences !
sub find-repeats($sequence, $min-repeat-length = 3) { my @repeats; for ^($s...return @repeats; } # Example usage my $genome-sequence = "ATCGATCGATCGATCG"; my @result = find-repeats($genome-...122 days ago
Raku script to find microsatellites in DNA fragments !
sub find-microsatellites($sequence, $min-repeat-length = 2, $max-repeat-length = 6, $mi...microsatellites.unique; } # Example usage my $genome-sequence = "ATCGATCGATCGATCGATCG"; my @result = find-microsatellites($genome-...122 days ago
Perl script to calculate the basic stats of the assembled genome !
#!/usr/bin/perl use strict; use warnings; use Bio::SeqIO; # Input file containing the genome assembly in FASTA format my $input_file = 'genome_assembly.fasta'; # Create Bio::SeqIO object to...nt the computed statistics and information print "Genome...122 days ago
Python script for basic stats of the assembled genome !
from Bio import SeqIO import statistics # Input file containing the genome assembly in FASTA format input_file = 'genome_assembly.fasta' # Variables for computing statistics...# Print the computed statistics and information print("Genome...122 days ago