X BOL wishing you a very and Happy New year

Alternative content

Our Sponsors



Download BioinformaticsOnline(BOL) Apps in your chrome browser.




Raku script to find microsatellites in DNA fragments !

  • Public
By LEGE 381 days ago
sub find-microsatellites($sequence, $min-repeat-length = 2, $max-repeat-length = 6, $min-repeat-count = 3) { my @microsatellites; for my $repeat-length ($min-repeat-length..$max-repeat-length) { for ^($sequence.chars - $repeat-length * $min-repeat-count + 1) -> $i { my $substring = $sequence.substr($i, $repeat-length); if $sequence.contains($substring x $min-repeat-count) { @microsatellites.push($substring); } } } return @microsatellites.unique; } # Example usage my $genome-sequence = "ATCGATCGATCGATCGATCG"; my @result = find-microsatellites($genome-sequence); say "Microsatellites found: ", @result;