Results for "6"
Bio-Scripts
Install BLAST in Ubuntu/Linux and Window !
.../ftp.ncbi.nlm.nih.gov/blast/executables/blast+/2.7.1/ncbi-blast-2.7.1+-win64.exe with your web browser..../ftp.ncbi.nlm.nih.gov/blast/executables/blast+/2.7.1/ncbi-blast-2.7.1+-win64.exe #Run this installer...1188 days ago
- ...se XML::XPath::XMLParser; # Use DAS of UCSC to fetch specific sequence by its given chromosome position # From here: https://www.biostars.org/p/6156/ my $chr = shift; my $po...
2951 days ago
- ...rom a normal distribution #USAGE: CI_tdist(matrix[,x],97.5) - single column from a t distribution #Created and updated by Santhilal Subhash on 2016/06/07 CI_normal 1) { for(...
2913 days ago
Perl script to insert sequence in contig !!
...} $s = "ATATGATGATAGATGATAGTAGATAGATAGATAGATAGATAG"; print "s = $s \n"; print 'insert = '.($s = insertSEQintoCONTIGatLOC( "CCCC ", $s , 26 ))."\n"; print " (now, s...2750 days ago
- ...this program with the flag # -h. require v5.6.0; use GD; use DB_File;...e image. default: = 600 is a title t...TEMPFILE = (); dbmopen(%TEMPFILE, "$dotfile", 0666) || die "Can't open databas...
2734 days ago
BASH script for SelfBLAST a genome
...echo "Doing alignments -- BLASting"; blastn -task megablast -query $SEQ -db $MYDB -evalue 1e-5 -num_threads $THREAD -max_target_seqs 1 -outfmt '6 qseqid staxid qstart qend sse...2693 days ago
picard tools command to get some insert statistics
#picard tools to get some insert statistics to see whether our reads seem to be in the correct place #module load picard/2.0.1 java -Xmx16g -XX:PermSize=8g -jar $PICARD_HOME/pi...1378 days ago
- #!/bin/env perl use strict; use warnings; use Imager::Heatmap; my $hmap = Imager::Heatmap->new( xsize => 640, # Image width ysize => 480, # Image...
2536 days ago
- bio
2511 days ago
- ...ld_180 scaffold_182 scaffold_184 scaffold_219 scaffold_219 scaffold_267 scaffold_273 scaffold_282...old_282 scaffold_458 scaffold_470 scaffold_480 scaffold_521 scaffold_644); foreach my $i (@ids) {...
2507 days ago
